Dataset for CDS BAK1 of Organism Colobus angolensis palliatus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A2K5IYH0_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BAK1 (length=636 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggtcaccttgcccctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgctgcagcacctgcagcccacggcagagaacgc
ctatgagtacttcaccaagattgcctccagcctgtttgagagtggcatcaactggggccgtgtggtggctcttctgggct
tcggctaccgtctggccctacacgtctaccagcgcggcctgactggcttcctgggccaggtgacccgcttcgtggtggac
ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggcagccctgaacttgggcaatggtcc
catcctgaacgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2K5IYH0_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BAK1 (length=462 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggtcaccttgcccctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgctgcagcacctgcagcccacggcagagaacgc
ctatgagtacttcaccaagattgcctccaggccagcagcaacacccacagcctgtttgagagtggcatcaactggggccg
tgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcgcggcctga
© 1998-2018