Dataset for CDS BAX-like of Organism Clarias batrachus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A0X9GII2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Clarias batrachus GN=BAX (length=582 residues).
atggcagcggcgctgtcaggaggaggcgatgggggcagcagtaatgaccaaatactagaaataggagccgtgttgctgaa
ggagtttatttacgaacgagtccgtcgtcatggcgacagcagcgctgtagtgtcgcggaacgaactgggtgggagtgagc
tgtgcgaccccacccataagaaactcgctcagtgtttacagcagattggggacgagctggacaaccatgcagacctgcag
agaatgctctctgactcatcgctccagccgactaaagacgtgttcgtaaaggtggcacgcgagatcttctcagatgggaa
gtttaactggggcagagtggtggcgcttttctacttcgcctgtcgactcgtgatcaaggctcttctgacaaaaatcccag
acatcatcaggaccatcatcaactggacgctggactacctgcgggagcacgtgattaattggattagagaacagggagga
tgggagggcatccgctcctacttcggcacaccgacctggcagacggtgggcgtctttctggccggagtcctcaccaccgt
tctggtcatgcgcaagatgtga
© 1998-2018