Dataset for CDS Unclassified of Organism Ciona savignyi

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|H2Z3W0_uncBOK-01 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Ciona savignyi (length=810 residues).
atggcgtcaaggtgtaaggtcaccccaaatgcgaatgacgtcaaccataactctgtattcgagccaattgagaccaataa
gccttcgtcggtgctgcaatctatgaactcgttcatgcgtgacagcgtctcttacgtcacgtcttcatgtgccagtatgg
cttcgtcgcttgcgtcatatggcgacgattcggtcttccactctacgtcatacgaagatgacgtcacacttaccatcggt
atttgccgagattacatatgctaccgagtgaagcgtgacgggttcgggtcacgtgtaacggtgaagttgtacgccccagc
cgtagatcaaacgatgtcttccaacattttaaatttaggcagttctttcgagcgaatgtttccgaagtcttttcggcaag
tttcgcgacaaatcggatgcttgttcaattccgaagatgccattcgtcgcttgtatttccgattggcagtccacatacta
ggtgtgcttgaagagaattatacgtgggggaggatactggcgctattggctctggcgggcgccatggcggttgattgcat
ttcacagggacacccgggactcgtggaaccgatgattgcaatctcaagtgatttcattcggaagaactcgttagattgga
tcatcaaaaaaggaggctggcacgctctggtggatcacttctctcccgaatctgcgcaaccgtgctggtcaggactatgc
ttgctgaagtcgcataccgcgcttccagtagctttatttatcttttcattattgttactagcacttgtaattcatctttt
tagcgtggac
>gnl|bcl2dbcds|H2ZK76_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Ciona savignyi (length=756 residues).
atgaaatcaacgaaaatggtccagcagacaaggagagtggtggaggattacattctctaccgaataaacgatgcaatcac
aaacgagactttcgactcattttcctcgcgctgcagcggagtggaccaggcctggagggggtttcccttaccccaaagta
accccgctaaactgtacttagcaatgcggaaaattggagctgactatgaaaggagatataaagaaacatttccagattta
ctcgacgaaattaaatctgtcaacatgtcaactgatgacgttgaccgaaccttctcaagaatatgcaaggacctcttccg
attaccgctaaagaaagcattccaggacaccctgaacacgaggcccgccggccccgatcaagccaccaataaagtctaca
ttcaaagcgacattcttaatgtggacgacggccacatcaaatggggacatgtaatcgcgcttctagtttttgccgcaatc
gtggctgtgcgagcggttgagctgaggaaaccagaacaggttgacgcaatcgtatcgtgggtcacaaagtttattgatgc
ggaacttagtagttggttgaacaagcaaggtggatgggataacttgttggaatggagtgaaggcgaacatcacttacagc
gtcagaccgacattagttttaacccaaaggactttgctacttcatttcgctctgcaataagtgtgggggtggtagctgcg
tgtgtcggcttgggtgctttaatgttaacccggaaa
© 1998-2018