Dataset for CDS Unclassified of Organism Ciona intestinalis

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|F6TGL0_uncBOK-01 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Ciona intestinalis (length=537 residues).
atgcagaaacacctttatagtgacgtgtcgaaacagattggaatcacattacgatcagaagatgttttacggaaagtatt
ttttgaacttgctggtgaaattctgaccacggaacccgtgacgataccgaaagaagcgaccgtcaatggtgaaacgaaaa
aagaaaaatcgcgcgcctttgtttcaagcggctccagaataatcgagataacgtggggtcgtatttgtgccgtggtagca
attgctggaggtttatccatagactgtgtaaaccagggacattcagacttagttaaccaacttatcgaattttgcggtga
atttgcaagcgaggaaggtgtcttgagatggatagtttcacaagggggttgggaaactctgagagaaatgactgatgacc
attctgctagtcatacggccaatgactacggatatttaactcacatctgtaatgttgcattagcgttgaccgcgtgtacc
ctagcaacagttttgagtgttgtagcgattgccagcgtttccgacactgccggatag
>gnl|bcl2dbcds|F6WDB5_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Ciona intestinalis (length=738 residues).
atggttcaacaaactagaagggtggttgaggactatgttttgtttcggatccacgaaacaatcgcttccgaatcgtacga
ctctttttcatcccgttgtaaactcgaggatcaagcatccagggggtttcccttaccccagactaaccccgctcgattga
atgtttcgattcgaaagattgcggcagaatacgagagaagatacagagaaacatttccggacttactggaggagataaag
acagtaaacatgtcaactgatgacgtcgacaaaacattttcgcgaatctgtaaagatttattccaacttcctctcaaacg
gaattacccggataacgctatgaagtcacaagcaaccagcaactccaagatatttatacaaagtgacattttggaggtgg
aagacaaccatgttaaatggggacatgttattgctttgctggtgttcgcagccattgttgctgtgcgggccgtggaactt
aaaaaacatgaacaagttgacgcgattgtttcgtgggtttcaaagtttatcgacaccgagcttactgggtggctgaacaa
gcagggtggatgggaaaacgtaattgaatggagtgaagcaggagagacaagacttcagttacaaaaagatacgagtttcg
atccaaataacttttcgtcatcgtttcgttcagcgataagcgttggtgttgttgctgcgtgcgttgggttgggagcttta
attatgacccggaagtga
>gnl|bcl2dbcds|F7ABX1_uncBOK-01 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Ciona intestinalis (length=801 residues).
atgacgtcatacactagtgacgtcaaccacaattctatctatgaaacagagcgaaaaaacaagcggactttgctggcgga
caatataaactcgatcatgcgtgacagtgtcacttttgtgacgtcatcaatcgcggacctgacgtcatcatgtgtctctc
ttggagacgactcggtttttaactcaacttcgtacgaagaggacgttcggctcacaaccggcatctgtagagattatatt
tgctaccgactgaagcgtgacgggttcggggaacgagttactgtgactgaacatgcgccggcacacaatcataacctttc
aaataagatattgaatttaggtagcggttttgagcgtatgtttccgaagagttttcggcagatttcgcgacaaatcggat
acgtgttcagttcagaggcgaccgtacgaagattgtatttcagaatgggcgttcatattatgggagttgtcgaatgcaat
tatacatggggaagaattttgtcgcttctggggcttgctggtgctatggctgttgactgcatatctcaaggacacccaga
actcgctgaatcgatgattggaatctcgagtgattttattcaaagaaatgctcttgattggattataaagcatggtggtt
ggggtggcttggtcgataacttttccccgaaacctatgaaatcgtattggtcaacacggaatattttgaaatggaatgga
ggtgtcactctcgctgtatttattcttctctttgcactaatgctggctattctaccacgtttaaaaaccaacgataacta
a
© 1998-2018