Dataset for CDS BAX of Organism Ciona intestinalis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|F6YVN3_BAX-01 BCL2-associated X gene OS=[Eukaryota] Ciona intestinalis GN=BAX (length=495 residues).
tttctcttgaacatgttcatacaagatcgagctggtgtagagaacagcccagttgagcctgtgagtgcgggatttaccga
tgaaaacttgagtgacattgcagtaacgctcagaagaataggagatgacatgtctcgtgatattcaactaaaccggttta
ttgatcaagtgccactgaaatccaccaaagatattttcatcaaagtgtgcttacaaatgtttgaggacggcaacttcaat
tggggtagaattgtagctttgttttattttgcataccgtctcattgtaagatctctcctcagtggtctcgacagtctgcc
atggattcgtgagctcatctcttgggttgttgacttcattgtgaagaagttcgccaagtggattatcagtcgtgggggat
ggacaatgataaaggaatggtttggaatttcgtcccaaacgtttggtgtgcttatatgtgttacccttgctatagtgggc
tgggcagtttttaag
© 1998-2018