Dataset for CDS BAX-like of Organism Chlorocebus sabaeus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A0D9R0C9_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Chlorocebus sabaeus GN=BOK (length=639 residues).
atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggatgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctgggccgggagtacgtgcacgcgcggctactgcgcgccggcctctcctggagcgcgcccg
agcgcgccgcgcctgtcccgggacgcctggccgaggtgtgcgcggtgctcctgcgcctgggggacgagctggagatgatc
cggcccagcgtctaccgcaacgtggctcgtcagctgcacatctccctgcagtctgagcctgtggtgaccgatgcgttcct
ggccgtggctggccacatcttctctgcaggcatcacgtggggcaaggtggtgtccctgtatgcggtggccgcggggctgg
ccgtggactgtgtgaggcaggcccagcctgccatggtccacgccctcgtggactgcctaggggagtttgtgcgcaagacc
ctggcaacctggctgcggagacgcggtggatggactgatgtcctcaagtgtgtcgtcagcacagaccctggcctccgttc
ccactggctggtagccgcactctgcagctttggccgcttcctgaaggctgccttcttcgtgctgctgccagagagatga
>gnl|bcl2dbcds|A0A0D9RB69_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BAK1 (length=636 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggacaccttgcccctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgctgcagcacctgcagcccacggcagagaacgc
ctatgagtacttcaccaagattgcctccagcctgtttgagagtggcatcaactggggccgtgtggtggctcttctgggct
tcggctaccgtctggccctacacgtctaccagcacggcctgactggcttcctgggccacgtgacccgcttcgtggttgac
ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggcagccctgaacttgggcaatggtcc
catcctgaacgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A0D9S330_BAX-01 BCL2-associated X gene OS=[Eukaryota] Chlorocebus sabaeus GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggagacacccgagctggccctggacccggtgcctcaggatg
cgtccaccaagaggctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgtgttgtcgcccttttctactttgccagcaaactggtgcttaaggccctgtgtaccaaggtgcccgaactgatca
gaaccatcatgggctggacactggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggc
ctcctctcctactttgggacgcccacgtggcagaccgtgaccatcttggtggctggagtactcaccgcctccctcaccat
ctggaagaagatgggctga
© 1998-2018