Dataset for CDS BAX of Organism Chlorocebus sabaeus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A0D9S330_BAX-01 BCL2-associated X gene OS=[Eukaryota] Chlorocebus sabaeus GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggagacacccgagctggccctggacccggtgcctcaggatg
cgtccaccaagaggctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgtgttgtcgcccttttctactttgccagcaaactggtgcttaaggccctgtgtaccaaggtgcccgaactgatca
gaaccatcatgggctggacactggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggc
ctcctctcctactttgggacgcccacgtggcagaccgtgaccatcttggtggctggagtactcaccgcctccctcaccat
ctggaagaagatgggctga
© 1998-2018