Dataset for CDS BAK1 of Organism Cercocebus atys

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A2K5KTQ1_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Cercocebus atys GN=BAK1 (length=525 residues).
atggcatcagggcaaggcccagggtttcccaggcaggagtgcggagagcttgccctgccctctgcttctgaggagcaggt
aacccgggacatggagaaggtttttgaccgccatcagcaagaacaggaggctgaagggccagccgcccctgccgacccag
agatggtcaccttgcccctccaacctagcagcaccgtggggcaggtgggacggcagatcaccatgctgcagcacctgcag
cgcacagcagagaacgcctacgagtacttcaccaagatcgcctccagcctgtttgagagtggcatcaaccagggccgtgt
ggtggctctcctgggcttcagctaccatctggtcctacatgtctaccagcgcggcttgactggcttcctgggccaggtga
cccgcttcgtggtcttcatgctgcaacactgcatcgcctggtggatcgcgcagaggggcagctgggtgtctttgccttct
ctgctcccgtgcaggggttgcccttcaaaagcacagaagctttag
>gnl|bcl2dbcds|A0A2K5KTQ1_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Cercocebus atys GN=BAK1 (length=570 residues).
atggcatcagggcaaggcccagggtttcccaggcaggagtgcggagagcttgccctgccctctgcttctgaggagcaggt
aacccgggacatggagaaggtttttgaccgccatcagcaagaacaggaggctgaagggccagccgcccctgccgacccag
agatggtcaccttgcccctccaacctagcagcaccgtggggcaggtgggacggcagatcaccatgctgcagcacctgcag
cgcacagcagagaacgcctacgagtacttcaccaagatcgcctccagcctgtttgagagtggcatcaaccagggccgtgt
ggtggctctcctgggcttcagctaccatctggtcctacatgtctaccagcgcggcttgactggcttcctgggccaggtga
cccgcttcgtggtcttcatgctgcaacactgcatcgcctggtggatcgcgcagaggggcagctgggtggcagccctggac
ttgggcaatggtcccatcctgaacatgctggtgattctgggggtggttctgttgggcccgtttgtggtacaaagattctt
caaatcatga
>gnl|bcl2dbcds|A0A2K5KTQ1_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Cercocebus atys GN=BAK1 (length=519 residues).
atggcatcagggcaaggcccagggtttcccaggcaggagtgcggagagcttgccctgccctctgcttctgaggagcaggt
aacccgggacatggagaaggtttttgaccgccatcagcaagaacaggaggctgaaggcagcaccgtggggcaggtgggac
ggcagatcaccatgctgcagcacctgcagcgcacagcagagaacgcctacgagtacttcaccaagatcgcctccagcctg
tttgagagtggcatcaaccagggccgtgtggtggctctcctgggcttcagctaccatctggtcctacatgtctaccagcg
cggcttgactggcttcctgggccaggtgacccgcttcgtggtcttcatgctgcaacactgcatcgcctggtggatcgcgc
agaggggcagctgggtggcagccctggacttgggcaatggtcccatcctgaacatgctggtgattctgggggtggttctg
ttgggcccgtttgtggtacaaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2K5N1M7_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Cercocebus atys GN=BAK1 (length=462 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgctgatccagagatggacaccttgcccctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgctgcagcagctgcagcccacggcagagaacgc
ctatgagtacttcaccaagattgcctccaggccagcagcaacacccacagcctgtttgagagtggcatcaactggggccg
tgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcacggcctga
>gnl|bcl2dbcds|A0A2K5N1M7_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Cercocebus atys GN=BAK1 (length=636 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgctgatccagagatggacaccttgcccctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgctgcagcagctgcagcccacggcagagaacgc
ctatgagtacttcaccaagattgcctccagcctgtttgagagtggcatcaactggggccgtgtggtggctcttctgggct
tcggctaccgtctggccctacacgtctaccagcacggcctgactggcttcctgggccaggtgacccgcttcgtggtcgac
ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggcagccctgaacttgggcaatggtcc
catcctgaacgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
© 1998-2018