Dataset for CDS Unclassified of Organism Cavia porcellus

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|H0VIM5_uncBAX-02 Putative BCL2-associated X gene OS=[Eukaryota] Cavia porcellus (length=222 residues).
atggacgggtccggcgagcaccctagaggaagcgggcccaccagctctgagcacatcatgaagacaggggcccttttgct
tcaggggatgattgcggccgtggacacagactccccccgagaggtctttttccgagtggcagctgaaatgttcgctgatg
gcaacttcaactggggccgggttgtcgcccttttctattttgccagcaaactggtgctcaag
>gnl|bcl2dbcds|H0VIM5_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Cavia porcellus (length=579 residues).
atggacgggtccggcgagcaccctagaggaagcgggcccaccagctctgagcacatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgcatgggcggggacactttggaactggccatggagccggcgccccaggacg
cgtccaccaagaagctgggcgagtgtctcaagcgaattggggacgaactggacagcaatatggagctacagaggatgatt
gcggccgtggacacagactccccccgagaggtctttttccgagtggcagctgaaatgttcgctgatggcaacttcaactg
gggccgggttgtcgcccttttctattttgccagcaaactggtgctcaaggcgctgtgcaccaaggtacccgagctgatca
ggaccatcatgggctggacactagacttcctccgagaccgcctgctgagctggatccaggaccagggtggctgggatggc
ctcctctcgtactttggaaccccgacctggcagacggtgaccatctttgtggccggcgtgctcaccgcctcactgaccat
ctggaagaacatgggctga
© 1998-2018