Dataset for CDS BOK of Organism Cavia porcellus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A286XGM4_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Cavia porcellus GN=BOK (length=540 residues).
gtgagaatcaggttggtggcaatggggttaggtgaagtcaagtggagatcagcctggaggtcatggggccccagccagcc
tggcatgggagctgtctctcactcacatgtgtgtccaccaggggacgagctggagcagattcggcccagtgtgtaccgca
acgtggcccgccagctgcacatctccctgcagtcagagcctgtggtgactgatgcgtttctggctgtggcaggccacatc
ttctcagcaggcatcacatggggcaaggtggtgtccctctactcggtggctgcggggctggctgtggactgtgtgcgaca
ggcccagcctgccatggttcatgccctggtcgactgcctgggggagtttgtgcgaaagaccctggctacctggctgcggc
ggcgtggcggatggaccgatgtcctgaagtgtgtggtcagcaccgatcccagcctccactcccactggctcgtggccgcg
ctgtgcaactttgggcgcttcctgaaggccgccttctttgtgctcttgccagagagatga
© 1998-2018