Dataset for CDS BAX-like of Organism Cavia porcellus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A286XGM4_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Cavia porcellus GN=BOK (length=540 residues).
gtgagaatcaggttggtggcaatggggttaggtgaagtcaagtggagatcagcctggaggtcatggggccccagccagcc
tggcatgggagctgtctctcactcacatgtgtgtccaccaggggacgagctggagcagattcggcccagtgtgtaccgca
acgtggcccgccagctgcacatctccctgcagtcagagcctgtggtgactgatgcgtttctggctgtggcaggccacatc
ttctcagcaggcatcacatggggcaaggtggtgtccctctactcggtggctgcggggctggctgtggactgtgtgcgaca
ggcccagcctgccatggttcatgccctggtcgactgcctgggggagtttgtgcgaaagaccctggctacctggctgcggc
ggcgtggcggatggaccgatgtcctgaagtgtgtggtcagcaccgatcccagcctccactcccactggctcgtggccgcg
ctgtgcaactttgggcgcttcctgaaggccgccttctttgtgctcttgccagagagatga
>gnl|bcl2dbcds|H0UT71_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Cavia porcellus GN=BAK1 (length=645 residues).
atggcatcagaccaaggcccaggtcctctccgggagggctgcggaggggcctccccgctgtctgaggaggagcagcaggt
ggtccgggacaccgaggaagttttccagagctacgtgtaccatcgccaccagcaggatagaggagggacacagggccggg
tacctcgggcgcatcctactgctcactgctgcttcctgtccagcaccctgacccaggtgggctgccagctggccatcatc
ggagacgacatcaaccggcgctatggcagtgacattgaagccatgctccagcagctgcagcccacggcggacaacgcccc
ggacctgttctacaagatcgcctgcagcctgtttaagcccggccccacctggggccgcgtggtggctctcctggccttcg
gctaccgcctagccctgcatgtctaccagcagcacggcctgtctggctttctgggcaaggtgaccaggcttgtagtcgac
agcatgctgcagttaaacgtggtccggtggatcgtggagaaaggcggctgggtggcagccctggactgggccggaacctt
ccgccccatctggactgtggttacagccttcgccattgtcatggtgggccagtatgtgatacgaagattcttcaagtcat
cgtga
© 1998-2018