Dataset for CDS BAX of Organism Cavia porcellus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A286Y2U9_BAX-01 BCL2-associated X gene OS=[Eukaryota] Cavia porcellus GN=BAX (length=579 residues).
atggacgggtccggcgagcaccctagaggaagcgggcccaccagctctgagcacatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgcatgggcggggacactttggaactggccatggagccggcgccccaggacg
cgtccaccaagaagctgggcgagtgtctcaagcgaattggggacgaactggacagcaatatggagctacagaggatgatt
gcggccgtggacacagactccccccgagaggtctttttccgagtggcagctgaaatgttcgctgatggcaacttcaactg
gggccgggttgtcgcccttttctattttgccagcaaactggtgctcaaggcgctgtgcaccaaggtacccgagctgatca
ggaccatcatgggctggacactagacttcctccgagaccgcctgctgagctggatccaggaccagggtggctgggatggc
ctcctctcgtactttggaaccccgacctggcagacggtgaccatctttgtggccggcgtgctcaccgcctcactgaccat
ctggaagaacatgggctga
>gnl|bcl2dbcds|A0A286Y2U9_BAX-02 BCL2-associated X gene OS=[Eukaryota] Cavia porcellus GN=BAX (length=222 residues).
atggacgggtccggcgagcaccctagaggaagcgggcccaccagctctgagcacatcatgaagacaggggcccttttgct
tcaggggatgattgcggccgtggacacagactccccccgagaggtctttttccgagtggcagctgaaatgttcgctgatg
gcaacttcaactggggccgggttgtcgcccttttctattttgccagcaaactggtgctcaag
© 1998-2019