Dataset for CDS BAX-like of Organism Castor fiber

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A1L5BWY0_BAX-01 BCL2-associated X gene OS=[Eukaryota] Castor fiber GN=BAX (length=579 residues).
atggatgggtccggggagcagcccagaggaggcgggcccaccagctctgagcagatcatgaagacgggggcccttttgct
tcagggtttcatccaggatcgagcagggcggatggggggggagacaccggagctgaccttggagcagatgcaccaggatg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gcagatgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgtttgccgacggcaacttcaattg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtaccggagctgatca
gaaccatcatgggctggacgctggaattcctccgagaacggctgctaggctggatccaagaccagggtggttgggacggc
ctcctttcctactttgggacccccacgtggcagacagtgaccatctttgtggctggagtgctcactgcctcgctcaccat
ttggaagaagatgggctga
© 1998-2018