Dataset for CDS BOK of Organism Carassius auratus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|B0I3D7_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Carassius auratus GN=BOK (length=624 residues).
atgttgcgccgctcctctgtgtttgcggctgaagtcatggaggcgtttgatcgctctcccacggacaaggagctcgtgtc
tcagtctaaagtcttgtgcagggactacattcactccagactccatcagctgggatcggatggtctaaaccagagcatgg
atccggaggaacactggctgaggtgtcgtcagtcttctgtggttggtgatgagctggagtacctgcgacccaatgtgtac
cgcaacgtagcaagacagctcaacatctccatttcctctgagagcatagtctctgatgcctttttggccgttgctgcaga
aatcttctctacaggtgtaacatgggggaagattgtgtctctgtatgccgtggccggagctctggctgtggactgtgtta
ggcaagggtatccagcgatggtgcacaccattgtcgactgcatgggcgagtttgttcgcaagagcctagtgtcgtggtta
aagaggagaggaggctgggtggacattacaaagtgtgtagtcaatacagatcccagttttcgttctcattggctggtggc
agctgcctgtgcctgtggtcacttcctcaaggctgtggtcttctacctgctgagagaaaaataa
© 1998-2018