Dataset for CDS BAX-like of Organism Capra hircus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A076FVB8_BAX-01 BCL2-associated X gene OS=[Eukaryota] Capra hircus GN=BAX (length=579 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggagagacacccgagctgggcttggagcaggtgccccaggatg
catccaccaagaagctgagcgagtgtctgaagcgcattggagatgaattggacagtaacatggagctgcagaggatgatc
gcagccgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatgttttccgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
ggaccatcatgggctggacattggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
ctcctctcctactttgggacacccacatggcagacggtgaccatctttgtggctggagtgctcaccgcctcgctcaccat
ctggaagaagatgggctga
© 1998-2018