Dataset for CDS Unclassified of Organism Capitella teleta

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|R7T396_uncBOK-01 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Capitella teleta (length=498 residues).
atgctccctcacaaattggaggtgtgcctccgtggaattcgtcccgattctaggatatccaacgcttcgtttgaggtctc
tcggattggagctgagttggagcgactgcatcctggaacatacaccaacatctctcgccagttacagctgaccctgcact
cggaggctgtgattcacagagccatgctgttgatggccgactctatgttcaaaagtccaaatgtgttaacatggggacga
gtggtatccttattcgccataacgtctgccctcgctggtgactgcatccagcaaggccactcggaattcgttaaatgtgt
gattgaaacttttgttgaagttgtcaagaagtacattgcgccatgggtggttagacagggcggttggcctgatgtctgtc
gaactttccagacagaccctgattacacgacggtgatcatcttctctcttattggagcggtgatggcactgatcacctac
gttttatattttaattga
>gnl|bcl2dbcds|R7TNP5_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Capitella teleta (length=387 residues).
atgtcacaagaaatgacatacgtgcttgccaaggacctcattgagcatatcacaaaggaaaaatcgggatcacgtttttc
tcattctcctgttaatcaccaccacgctgaaaccttacgtcgagaggtgtgcaagaaaatgtttagtgatgaacatgtga
actggggacgagttgtgaccattttcgcgtttgccgccgcttgcgctcaacgtgttgttgtggtggataagaatatcaac
atgaatgtgaaacggaccattatagaggtattgacggcatttgtgaatgaaactcttcagtgttggattacggaccaacc
aggaggttgggacgcaatgatcatattttcagagattcgaagaaaaaatgaaggaatgagtgagtga
>gnl|bcl2dbcds|R7U8A2_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Capitella teleta (length=300 residues).
atgttgagtgacggacaattgaactggggtcgagttgtatctctgttcgcctttgcctctgctttggctcaacacttcca
cacctcccctcaactctcacacttagtccctacagttacgaaactacttgcagaattcgtctcccttcgcctcactccct
ggatagtgaagcagggtggatgggatgcgtttgatcgatatttcccagaaccgaatggcgtcgagaacagcatttggaag
ggacttctatacacgtttgtcggattgggcgcccttgcttcagtggtcgctgccagataa
© 1998-2018