Dataset for CDS BAX of Organism Canis lupus familiaris

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|F1PAN9_BAX-01 BCL2-associated X gene OS=[Eukaryota] Canis lupus familiaris GN=BAX (length=549 residues).
atgagccaccctagttcgctgggtcccctaggacccaagagtccaggcacctcttccctcctttctcctctagggcccac
cagctctgagcagatcatgaagacaggggcccttttgcttcagggtttcatccaagatcgagcagggcgaatggggggag
agacacctgagctgcccttggagcaggtgccccaggatgcatccaccaagaagctgagcgaatgtctcaagcgcatcgga
gatgaactggacagtaacatggagttgcagaggatgatcgcagctgtggacacagactctccccgtgaggtcttcttccg
agtggcagctgagatgttttctgatggcaacttcaactggggccgggttgttgccctcttctactttgccagcaaactgg
tgctcaaggccctgtgtaccaaggtgcccgagctgatcaggaccatcatgggctggacactggacttccttcgagagcgg
ctgctgggctggatccaggaccagggtggttgggtgaggcctgtaaccccctccccccaactcctctga
>gnl|bcl2dbcds|F1PAN9_BAX-02 BCL2-associated X gene OS=[Eukaryota] Canis lupus familiaris GN=BAX (length=492 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaagatcgagcagggcgaatggggggagagacacctgagctgcccttggagcaggtgccccaggatg
catccaccaagaagctgagcgaatgtctcaagcgcatcggagatgaactggacagtaacatggagttgcagaggatgatc
gcagctgtggacacagactctccccgtgaggtcttcttccgagtggcagctgagatgttttctgatggcaacttcaactg
gggccgggttgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgagctgatca
ggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggtgagg
cctgtaaccccc
>gnl|bcl2dbcds|Q8HYU5_BAX-01 BCL2-associated X gene OS=[Eukaryota] Canis lupus familiaris GN=BAX (length=579 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaagatcgagcagggcgaatggggggagagacacctgagctgcccttggagcaggtgccccaggatg
catccaccaagaagctgagcgaatgtctcaagcgcatcggagatgaactggacagtaacatggagttgcagaggatgatc
gcagctgtggacacagactctccccgtgaggtcttcttccgagtggcagctgagatgttttctgatggcaacttcaactg
gggccgggttgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgagctgatca
ggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
ctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggctggagtgcttactgcgtcactcaccat
ctggaaaaagatgggctga
© 1998-2018