Dataset for CDS BAX-like of Organism Callithrix jacchus

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|F6SBR3_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Callithrix jacchus GN=BOK (length=639 residues).
atggaggtgctgcggcgctcctccgtcttcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctcggcagggagtacgtgcacgcgcggctactgcgcgccggcctctcctggagcgcgcccg
agcgcgccgcgccgttcccggggcgcctggccgaggtgtgcgcggtgctgctgcgcctgggggatgagctggagatgatc
cgccccagcgtttaccgcaacgtggcgcgccagctgcacatctccctacagtccgagcctgtggtgaccgatgcattctt
ggccgtggccggccacatcttctctgcaggcatcacgtggggcaaggtggtgtccttgtatgcggtggccgcagggctgg
ccgtggactgcgtgaggcaggcccagcctgccatggtccacgcccttgttgactgcctgggagagtttgtgcgcaagacc
ctggccacctggctgcggaggcgcggtggatggactgatgtcctcaagtgtgtggtcaacacagaccctggcctccgctc
ccactggctgctcgccgcactctgcagctttggccgcttcctgaaggctgccttcttcgtgctcctgccagagagatga
>gnl|bcl2dbcds|F7ICC2_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Callithrix jacchus GN=BAK1 (length=636 residues).
atggcatcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgacccaccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccacagctacgttttttaccgccatcggcaggaacaggaggctgaaggggcggctg
cccctgctgacccagagatggttagcttgtctctccaacctagcagcaccatggggcaggtgggacggcagctcgctatc
attggggatgacatcaaccggcgctatgactcggagttccagaccatgctgcagcacctgcagcccacggcagagaacgc
ctacgagtacttcaccaagatcgcctccagcctgtttgagagtggcatcaactggggccgtgtggtggctctcctgggct
ttggctaccgtctggccctacacgtctaccagcgcggcctgactggcttcctgggccaggtgacccgcttcgtggtggac
ttcatgctgcatcactgcatcgcccggtggatcgcacagaggggtggctgggtggcagccctggacctgggcaatggacc
catcctgaatgtgctggtcgttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
>gnl|bcl2dbcds|U3BU97_BAX-02 BCL2-associated X gene OS=[Eukaryota] Callithrix jacchus GN=BAX (length=528 residues).
atggacgggtccggggagcaacccagaggcgagggtgaggcgggaggcagtcgggcgggagaagggcgaacacccgagct
ggccctggacccggtgccccaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgagctggaca
gtaacatggagctgcagaggatgattgctgctgtggatacagactccccacgagaggtcttttttcgagtggcagctgac
atgttctctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccct
gtgtgccaaggtgcccgagctgatcagaaccatcatgggctggactttggacttcctccgggagcggctgttgggctgga
tccaagaccagggtggttgggatggcctcctctcctacttctttgggacccccacatggcagacagtgaccatctttgtg
gctggagtgctcaccgcctcgcttaccatctggaagaacatgggctga
>gnl|bcl2dbcds|U3BU97_BAX-01 BCL2-associated X gene OS=[Eukaryota] Callithrix jacchus GN=BAX (length=582 residues).
atggacgggtccggggagcaacccagaggcgaggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggagaatcgcgggggagacacccgagctggccctggacccggtgccccaggatg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgagctggacagtaacatggagctgcagaggatgatt
gctgctgtggatacagactccccacgagaggtcttttttcgagtggcagctgacatgttctctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtgccaaggtgcccgagctgatca
gaaccatcatgggctggactttggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggatggc
ctcctctcctacttctttgggacccccacatggcagacagtgaccatctttgtggctggagtgctcaccgcctcgcttac
catctggaagaacatgggctga
>gnl|bcl2dbcds|U3BU97_BAX-04 BCL2-associated X gene OS=[Eukaryota] Callithrix jacchus GN=BAX (length=576 residues).
atggacgggtccggggagcaacccagaggcgaggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggagaatcgcgggggagacacccgagctggccctggacccggtgccccaggatg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgagctggacagtaacatggagctgcagaggatgatt
gctgctgtggatacagactccccacgagaggtcttttttcgagtggcagctgacatgttctctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtgccaaggtgcccgagctgatca
gaaccatcatgggctggactttggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggtgaga
cccctctacccttcctgcccagcctcccctgactcctctgggaccctgggccttccaagcaggtcacaatcatcagatgt
ggtctataatgcattt
>gnl|bcl2dbcds|U3BU97_BAX-03 BCL2-associated X gene OS=[Eukaryota] Callithrix jacchus GN=BAX (length=435 residues).
atggacgggtccggggagcaacccagaggcgaggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcaggggatgattgctgctgtggatacagactccccacgagaggtcttttttcgagtggcagctgacatgttctctgacg
gcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtgccaaggtg
cccgagctgatcagaaccatcatgggctggactttggacttcctccgggagcggctgttgggctggatccaagaccaggg
tggttgggatggcctcctctcctacttctttgggacccccacatggcagacagtgaccatctttgtggctggagtgctca
ccgcctcgcttaccatctggaagaacatgggctga
© 1998-2018