Dataset for CDS BAX-like of Organism Callithrix jacchus

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|F6SBR3_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Callithrix jacchus GN=BOK (length=606 residues).
atggaggtgctgcggcgctcctccgtcttcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctcggcagggagtacgtgcacgcgcggctactgcgcgccggcctctcctggagcgcgcccg
agcgcgccgcgccgttcccggggcgcctggccgaggtgtgcgcggtgctgctgcgcctgggggatgagctggagatgatc
cgccccagcgtttaccgcaacgtggcgcgccagctgcacatctccctacagtccgagcctgtggtgaccgatgcattctt
ggccgtggccggccacatcttctctgcaggtatgcccagcctgcccatcccctgggacctcagggagggatctggggtct
gcggctcagtcttacagggaccccacgagccagcccctgcccatcctggcgctgcccagtgctcactggtactatctcgc
tgctgtagatgtctggaactgcccagtgaccagtgcggatcctcaggactcaaactacagcattcagggtctctcgtggt
tctgtgggttggcgggcacgctgggcagctggcacaggcttcttga
>gnl|bcl2dbcds|F6SBR3_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Callithrix jacchus GN=BOK (length=639 residues).
atggaggtgctgcggcgctcctccgtcttcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctcggcagggagtacgtgcacgcgcggctactgcgcgccggcctctcctggagcgcgcccg
agcgcgccgcgccgttcccggggcgcctggccgaggtgtgcgcggtgctgctgcgcctgggggatgagctggagatgatc
cgccccagcgtttaccgcaacgtggcgcgccagctgcacatctccctacagtccgagcctgtggtgaccgatgcattctt
ggccgtggccggccacatcttctctgcaggcatcacgtggggcaaggtggtgtccttgtatgcggtggccgcagggctgg
ccgtggactgcgtgaggcaggcccagcctgccatggtccacgcccttgttgactgcctgggagagtttgtgcgcaagacc
ctggccacctggctgcggaggcgcggtggatggactgatgtcctcaagtgtgtggtcaacacagaccctggcctccgctc
ccactggctgctcgccgcactctgcagctttggccgcttcctgaaggctgccttcttcgtgctcctgccagagagatga
>gnl|bcl2dbcds|F7ICC2_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Callithrix jacchus GN=BAK1 (length=729 residues).
atgggtctgtgccactcctgggagctggggaggcctggggggtcttgcccttctctcatggctgctcctctttcatgttg
ggctcctacccccatccaggaccttgtatcctttttatttagcccatgcctgccccttgtcccagagcccagcattcatg
ttttagaacattgtcggggatctccaaggaggggtgcacagggccatggacagcttgggcagaaaccctctgccatgatg
caggccctggcccccactgcctggccacctgctcacctgcctgcctcccgctcacacagcaccatggggcaggtgggacg
gcagctcgctatcattggggatgacatcaaccggcgctatgactcggagttccagaccatgctgcagcacctgcagccca
cggcagagaacgcctacgagtacttcaccaagatcgcctccagcctgtttgagagtggcatcaactggggccgtgtggtg
gctctcctgggctttggctaccgtctggccctacacgtctaccagcgcggcctgactggcttcctgggccaggtgacccg
cttcgtggtggacttcatgctgcatcactgcatcgcccggtggatcgcacagaggggtggctgggtggcagccctggacc
tgggcaatggacccatcctgaatgtgctggtcgttctgggtgtggttctgttgggccagtttgtggtacgaagattcttc
aaatcatga
>gnl|bcl2dbcds|F7ICC2_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Callithrix jacchus GN=BAK1 (length=636 residues).
atggcatcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgacccaccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccacagctacgttttttaccgccatcggcaggaacaggaggctgaaggggcggctg
cccctgctgacccagagatggttagcttgtctctccaacctagcagcaccatggggcaggtgggacggcagctcgctatc
attggggatgacatcaaccggcgctatgactcggagttccagaccatgctgcagcacctgcagcccacggcagagaacgc
ctacgagtacttcaccaagatcgcctccagcctgtttgagagtggcatcaactggggccgtgtggtggctctcctgggct
ttggctaccgtctggccctacacgtctaccagcgcggcctgactggcttcctgggccaggtgacccgcttcgtggtggac
ttcatgctgcatcactgcatcgcccggtggatcgcacagaggggtggctgggtggcagccctggacctgggcaatggacc
catcctgaatgtgctggtcgttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
>gnl|bcl2dbcds|F7ICC2_BAK1-04 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Callithrix jacchus GN=BAK1 (length=573 residues).
atggcatcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgacccaccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccacagctacgttttttaccgccatcggcaggaacaggaggctgaaggggcggctg
cccctgctgacccagagatggttagcttgtctctccaacctagcagcaccatggggcaggtgggacggcagctcgctatc
attggggatgacatcaaccggcgctatgactcggagttccagaccatgctgcagcacctgcagcccacggcagagaacgc
ctacgagtacttcaccaagatcgcctccaggtaccccgaccacctccccgccggactctggtcactctcctgtcccgtga
caacctcaccatggcctgcctatatgatgcactcctggcctgggagacaccttctgtcggtgtccagtgtctgctgtgaa
ctcacatgtggtctcggcctcctatttttctctcttagggtcccagactcattcgtattttgtgcattagctcacagctc
ttttcagcactga
>gnl|bcl2dbcds|F7ICC2_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Callithrix jacchus GN=BAK1 (length=459 residues).
atggcatcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgacccaccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccacagctacgttttttaccgccatcggcaggaacaggaggctgaaggggcggctg
cccctgctgacccagagatggttagcttgtctctccaacctagcagcaccatggggcaggtgggacggcagctcgctatc
attggggatgacatcaaccggcgctatgactcggagttccagaccatgctgcagcacctgcagcccacggcagagaacgc
ctacgagtacttcaccaagatcgcctccaggccagcaacacccacagcctgtttgagagtggcatcaactggggccgtgt
ggtggctctcctgggctttggctaccgtctggccctacacgtctaccagcgcggcctga
© 1998-2019