Dataset for CDS BAX of Organism Botryllus schlosseri

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A165NNF9_BAX-01 BCL2-associated X gene OS=[Eukaryota] Botryllus schlosseri GN=BAX (length=780 residues).
atgtcggggggcggtgatcaagcgaagaaggaagcagggaagatagatgataaaaatgacgaggatcctcgaccatctag
gccaacccgaccgagaaccgccagaccaggtagaagaacagatcctgaatcgtctttggtccagggagctgttggtgggg
aaggttcatacacgagacatctaactgaggaggaaagagctgttggaaaccaagcaaggcatcttctgacaatgtttatc
tctgacagagcagaacgtgatcccgacctgtcgcaggataagaaaggagctgtacaggaaacagttcagttatgtaacaa
gagctcggaaagtaatgcgatgagcgatagcgatgctgctttaagggaggtatcattgaccttgcgtgttattggagatc
agttgaatgaagacaatgaccttaacagccttattgatagagttctcgttcaacccaccaaggacatcttcatgaaagtt
tgtaaacagatatttgccgatcaaaatttcaactggggcagagtagccgctgtattctactttgcgtacagacttataac
aaaggctgtatgcacaaccatggatgaaggcatagattggattaaagatattatgagttgggcgatggacttcttatatc
agtatgttctttggtggattgtccaaaggggaggttggggaatgatcagagaatactttggaacaccgactgcgtatgtg
gtttctctgtctgccgcaacaatacttactgttttgtatgtatggtggaagcagcaatga
© 1998-2018