Dataset for CDS BAX-like of Organism Bos taurus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A6H6W7_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Bos taurus GN=BOK (length=642 residues).
atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggctctcggccgcgagttcgtgcacgcgcgactgctgcgcgctggcctctcctggagcgcgcccg
agcgcgccgcgccggtccccggcggccgcctggcggaggtgtgcgccgtgctgctgcgcctggcggacgagctggagctg
atccggcccagtgtctaccgcaacgtggcccgccagctgaacctctccctgcagtcggagaccgtggtgaccgacgcctt
cctggctgtggcgacccagatcttttctgcaggcatcacgtggggcaaagttgtgtccctgtactccgtggccgcggggc
tggccgtggactgtgtgcggcaggcccagcccgccctggtgcacgccctcgtcgactgtctcggggagtttgtgcggaag
acgctggcaacctggctgcggaggcgtggtggatggacggacgtgctcaagtgcgtggtcagcaccgacccgggcctgcg
ctcgcactggctggtggccgcgctctgcagctttggccgcttcctgaaggcagccttcttcatgctgttgccggagagat
ga
>gnl|bcl2dbcds|O02703_BAX-02 BCL2-associated X gene OS=[Eukaryota] Bos taurus GN=BAX (length=1068 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggagagacacccgagctgggcttggagcaggtgccccaggatg
catccaccaagaagctgagcgagtgtctgaagcgcatcggagatgaattggacagtaacatggagctgcagaggatgatc
gcagctgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatgttttctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
ggaccatcatgggctggacattggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggtgaga
cctctaaccccaccccattcccccactcctctggggcccttgggcctttctgtgcccaccataggagtgcccccttcccc
attttggggtcatatgtctgatcaacccctgattcacagggtgcccaatgacctgtccatgacccttgacctccttgtga
cctctgacctcctagtgacccctgacccgatgcctcgatgccctccctggtgcctccctccaattcctctggaatccctc
aagttctatgataatcctttaacttccccactcgtaggcccttgcccctacttgtgccctctgacccctccctgctccct
catgtgctggcccaggggctgccccttggctgagtcgctgaagtgcctgctgtccctatccccaggacggcctcctctcc
tactttgggacacccacatggcagacagtgaccatctttgtggctggagtgctcaccgcctcgctcaccatctggaagaa
gatgggctgaggccatcaactgccttggactttttctgcataaattatggcatttttcaggggggtggggcggatttggg
ggccatggagtttttcttacttttttaa
>gnl|bcl2dbcds|O02703_BAX-03 BCL2-associated X gene OS=[Eukaryota] Bos taurus GN=BAX (length=1011 residues).
atgaagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatggggggagagacacccgagctggg
cttggagcaggtgccccaggatgcatccaccaagaagctgagcgagtgtctgaagcgcatcggagatgaattggacagta
acatggagctgcagaggatgatcgcagctgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatg
ttttctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtg
caccaaggtgcccgagttgatcaggaccatcatgggctggacattggacttccttcgagagcggctgctgggctggatcc
aggaccagggtggttgggtgagacctctaaccccaccccattcccccactcctctggggcccttgggcctttctgtgccc
accataggagtgcccccttccccattttggggtcatatgtctgatcaacccctgattcacagggtgcccaatgacctgtc
catgacccttgacctccttgtgacctctgacctcctagtgacccctgacccgatgcctcgatgccctccctggtgcctcc
ctccaattcctctggaatccctcaagttctatgataatcctttaacttccccactcgtaggcccttgcccctacttgtgc
cctctgacccctccctgctccctcatgtgctggcccaggggctgccccttggctgagtcgctgaagtgcctgctgtccct
atccccaggacggcctcctctcctactttgggacacccacatggcagacagtgaccatctttgtggctggagtgctcacc
gcctcgctcaccatctggaagaagatgggctgaggccatcaactgccttggactttttctgcataaattatggcattttt
caggggggtggggcggatttgggggccatggagtttttcttacttttttaa
>gnl|bcl2dbcds|O02703_BAX-01 BCL2-associated X gene OS=[Eukaryota] Bos taurus GN=BAX (length=579 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggagagacacccgagctgggcttggagcaggtgccccaggatg
catccaccaagaagctgagcgagtgtctgaagcgcatcggagatgaattggacagtaacatggagctgcagaggatgatc
gcagctgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatgttttctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
ggaccatcatgggctggacattggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
ctcctctcctactttgggacacccacatggcagacagtgaccatctttgtggctggagtgctcaccgcctcgctcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|Q05KI7_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Bos taurus GN=BAK1 (length=636 residues).
atggcttccggacaaggcccaggtccccccgggcaggactgcgacgagcctgacccctcctccacctcggaggagcaggt
ggcccgggacaccgaggaggtcttccgcagctacgtcttttaccgccatcagcaggaacaggaggccgagggggcggctg
cgcctactgacccagagatggtcaccttgcacccagaacctagcagcaccatggggcaggtgggccgccagctcgccgtc
atcggggacgacatcaaccggcgctacgatgcggagttccaggccatgctgcagcacctgcagccaacagcagacaacgc
ctatgagtacttcaccaagatcgcgtccagcctgtttgagagcggtatcaactggggccgcgtggtggctctgctgggct
ttggctaccgcctggccctccacgtctaccagcgcggcctgaccggcttcctgggccaggtgacccgcttcgtggccgac
ttcatgctgcgtcgctccatcgcccggtggatcgcgcagaggggtggctgggtggcagccctggacttggggaacggccc
catcaagagcgtagccatcgttctggctgtggttttgttgggccagtttgtggtacgaagattcttcaagtcatga
© 1998-2019