Dataset for CDS BAX of Organism Bos taurus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|O02703_BAX-01 BCL2-associated X gene OS=[Eukaryota] Bos taurus GN=BAX (length=579 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggagagacacccgagctgggcttggagcaggtgccccaggatg
catccaccaagaagctgagcgagtgtctgaagcgcatcggagatgaattggacagtaacatggagctgcagaggatgatc
gcagctgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatgttttctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
ggaccatcatgggctggacattggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
ctcctctcctactttgggacacccacatggcagacagtgaccatctttgtggctggagtgctcaccgcctcgctcaccat
ctggaagaagatgggctga
© 1998-2018