Dataset for CDS BAX of Organism Bos taurus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|O02703_BAX-02 BCL2-associated X gene OS=[Eukaryota] Bos taurus GN=BAX (length=1068 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggagagacacccgagctgggcttggagcaggtgccccaggatg
catccaccaagaagctgagcgagtgtctgaagcgcatcggagatgaattggacagtaacatggagctgcagaggatgatc
gcagctgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatgttttctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
ggaccatcatgggctggacattggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggtgaga
cctctaaccccaccccattcccccactcctctggggcccttgggcctttctgtgcccaccataggagtgcccccttcccc
attttggggtcatatgtctgatcaacccctgattcacagggtgcccaatgacctgtccatgacccttgacctccttgtga
cctctgacctcctagtgacccctgacccgatgcctcgatgccctccctggtgcctccctccaattcctctggaatccctc
aagttctatgataatcctttaacttccccactcgtaggcccttgcccctacttgtgccctctgacccctccctgctccct
catgtgctggcccaggggctgccccttggctgagtcgctgaagtgcctgctgtccctatccccaggacggcctcctctcc
tactttgggacacccacatggcagacagtgaccatctttgtggctggagtgctcaccgcctcgctcaccatctggaagaa
gatgggctgaggccatcaactgccttggactttttctgcataaattatggcatttttcaggggggtggggcggatttggg
ggccatggagtttttcttacttttttaa
>gnl|bcl2dbcds|O02703_BAX-03 BCL2-associated X gene OS=[Eukaryota] Bos taurus GN=BAX (length=1011 residues).
atgaagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatggggggagagacacccgagctggg
cttggagcaggtgccccaggatgcatccaccaagaagctgagcgagtgtctgaagcgcatcggagatgaattggacagta
acatggagctgcagaggatgatcgcagctgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatg
ttttctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtg
caccaaggtgcccgagttgatcaggaccatcatgggctggacattggacttccttcgagagcggctgctgggctggatcc
aggaccagggtggttgggtgagacctctaaccccaccccattcccccactcctctggggcccttgggcctttctgtgccc
accataggagtgcccccttccccattttggggtcatatgtctgatcaacccctgattcacagggtgcccaatgacctgtc
catgacccttgacctccttgtgacctctgacctcctagtgacccctgacccgatgcctcgatgccctccctggtgcctcc
ctccaattcctctggaatccctcaagttctatgataatcctttaacttccccactcgtaggcccttgcccctacttgtgc
cctctgacccctccctgctccctcatgtgctggcccaggggctgccccttggctgagtcgctgaagtgcctgctgtccct
atccccaggacggcctcctctcctactttgggacacccacatggcagacagtgaccatctttgtggctggagtgctcacc
gcctcgctcaccatctggaagaagatgggctgaggccatcaactgccttggactttttctgcataaattatggcattttt
caggggggtggggcggatttgggggccatggagtttttcttacttttttaa
>gnl|bcl2dbcds|O02703_BAX-01 BCL2-associated X gene OS=[Eukaryota] Bos taurus GN=BAX (length=579 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggagagacacccgagctgggcttggagcaggtgccccaggatg
catccaccaagaagctgagcgagtgtctgaagcgcatcggagatgaattggacagtaacatggagctgcagaggatgatc
gcagctgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatgttttctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
ggaccatcatgggctggacattggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
ctcctctcctactttgggacacccacatggcagacagtgaccatctttgtggctggagtgctcaccgcctcgctcaccat
ctggaagaagatgggctga
© 1998-2019