Dataset for CDS BOK of Organism Astyanax mexicanus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W5KF74_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Astyanax mexicanus GN=BOK (length=687 residues).
atggatttgatggatcgaggcccgagtgagaaggagctggttttccagtctaagatactgtgcagagacttcatttactc
caggatcaccagagaaggtctcaactggtccaaagttgaatcgtccctgcctgtaccagttccagacggagctcttggag
atgtctccatggtgcttctaaagcttggtgatgagctggagtacatgcggccgtatatctacaggaacgtggcgaagcag
ctcagtatatcggtgtctgtggagagcgtggtgtcggacgcttttctctctgtggcgacggagatcctctccctggggat
cacgtgggggaaggtggtggccatctttgcagtagctggggggtctggcggtggactgtgtccggcagggtcatccagcc
atgatactcactatagtggacagcctgggggagttcgtccggaagagcctggtgccctggctgaagaggagaggaggctg
gggagacatttcaaagtgtgtgacgagcgtggacactacacctccgtcccattggatgtctgcagtagtatcaacctgga
ggcacgttgtgaagaccatgtatatctacctgatgaagtaactgtggaagcagtagctgttaatacggctccaggactgg
aattactgggaagtctcagactgctcatgatctcagagctttactaa
© 1998-2018