Dataset for CDS BAX-like of Organism Astyanax mexicanus

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|W5KA26_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Astyanax mexicanus GN=BOK (length=648 residues).
atgaagggcatggaggttctgcgtcgttcctcagtgtttgcagcagaagtaatggaagtgtttgagcgctctcccactga
taaggaactcgtctcccagtccaaagttctgtgcagagactacatccactccaggctgaaccgggccggaatcggctggt
ccaaagctgaccacgggctgtctgcaggcgggtcgctgggggaggtgtcatcagtgcttctatggttaggtgacgagcta
gaatacctgcgtccgaatgtgtaccgcaacgtggcgcgccaactcaacattacggtggcatcagagagtgtggtgtctga
tgccttcctggcagtggcagcagaaatattctccacaggagtgacgtggggtaaggtggtctctctgtacgccgtagccg
gagctctggcggtagattgtgtccgacacggtcaccccgccatggtacatactattgtagactgcatgggcgagtttgtc
cgcaagagcctggtgtcctggttaaagagacgaggaggctggactgatatcaccaaatgcgttgtcaacacggaccccag
cttccgttctcactggctggtggcggcggcctgcacctgcgtgcactacctgaaggccgtggtgttctatctgctgagag
agaagtga
>gnl|bcl2dbcds|W5KCK0_BAX-01 BCL2-associated X gene OS=[Eukaryota] Astyanax mexicanus GN=BAX (length=582 residues).
tttttaaatcaccaaggaagtggaggatcaacgtacagaagtgttaatctgctacgcataggatataggctactgataaa
ctttatctctgagcgtcttcagcgcacattggaaattgatgctgcagtaaccaaaaacctgttggacgagacggaagagg
tgcctgatcccaacattaagaaagttggacagcgtctacagcagtttggagatgaactggacaatgacacagaattgaaa
aatatgataaatgactcggcgctacagcccacccaagacgtgtttgtgaaagtggcttgtgaaatcttctctgatgggaa
gtttaactggggcagggtggtggcgcttttctattttgcttgtcgactcgtcatcaaggctgtgctgactaagcttcctg
acatcatcagaaccatcatcaattggaccgtagactacctgcgggaacatgtgattaattggatcagggaacagggaggc
tgggaaggtatccggtcctactttggaacccctacctggcaaactgttggcgtctttctggctggagtgctcaccactgt
gctggtcatgcgcaaaatgtga
>gnl|bcl2dbcds|W5KCL0_BAX-01 BCL2-associated X gene OS=[Eukaryota] Astyanax mexicanus GN=BAX (length=318 residues).
atgattaataacctaatgcccacaaaagaagtgttcctgaaaatcgcctatgaaatcttctctgactggaagtttaactg
gggcagggtggtggcactgttctactttgcttgtgagtttgtcaagatggttcctgatatcatcagtaacatcatcagct
ggactctagaattcatgcgtgatcatgtgattgcatggatcagtggacagggaggctgggacgcaatcctctcacagatt
gaagcaccttcctggacaactgtcactgcatttgtggctggagttctcactactgctctcatcgtaaacaaaatgtga
>gnl|bcl2dbcds|W5KF74_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Astyanax mexicanus GN=BOK (length=600 residues).
atggatttgatggatcgaggcccgagtgagaaggagctggttttccagtctaagatactgtgcagagacttcatttactc
caggatcaccagagaaggtctcaactggtccaaagttgaatcgtccctgcctgtaccagttccagacggagctcttggag
atgtctccatggtgcttctaaagcttggtgatgagctggagtacatgcggccgtatatctacaggaacgtggcgaagcag
ctcagtatatcggtgtctgtggagagcgtggtgtcggacgcttttctctctgtggcgacggagatcctctccctggggat
cacgtggggaaaggtggtggccatctttgcagtagctgggggtctggcggtggactgtgtccggcagggtcatccagcca
tgatactcactatagtggacagcctgggggagttcgtccggaagagcctggtgccctggctgaagaggagaggaggctgg
ggagacatttcaaagtgtgtgacgagcgtggacactacacctccgtcccattggatgtctgcagtagtatcaacctggag
gcacgttgtgaagaccatgtacatctacctgatgaagtaa
>gnl|bcl2dbcds|W5KF74_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Astyanax mexicanus GN=BOK (length=642 residues).
aggaatttttttgctagaagtgagaacctcaagatcctgaagatggatttgatggatcgaggcccgagtgagaaggagct
ggttttccagtctaagatactgtgcagagacttcatttactccaggatcaccagagaaggtctcaactggtccaaagttg
aatcgtccctgcctgtaccagttccagacggagctcttggagatgtctccatggtgcttctaaagcttggtgatgagctg
gagtacatgcggccgtatatctacaggaacgtggcgaagcagctcagtatatcggtgtctgtggagagcgtggtgtcgga
cgcttttctctctgtggcgacggagatcctctccctggggatcacgtggggaaaggtggtggccatctttgcagtagctg
ggggtctggcggtggactgtgtccggcagggtcatccagccatgatactcactatagtggacagcctgggggagttcgtc
cggaagagcctggtgccctggctgaagaggagaggaggctggggagacatttcaaagtgtgtgacgagcgtggacactac
acctccgtcccattggatgtctgcagtagtatcaacctggaggcacgttgtgaagaccatgtacatctacctgatgaagt
aa
>gnl|bcl2dbcds|W5KJ41_BAX-02 BCL2-associated X gene OS=[Eukaryota] Astyanax mexicanus GN=BAX (length=615 residues).
atggcagattccggagacagcggggggaatgaggacagtgagctgttaggagctacaggtggagaagatgttgtagacga
ccaaatcgtagaacaaggcgcaatagtactgagagggtatgttcttcggcggctcagtacagagaaccctgatgtacgtg
tgagttgggtggaccttggtggaagacctgatgaaggcgatgaccctcaaataaaagtggttgtggagcagcttcttaga
attgctgatgatctgaatcgcaatactgagcttcaacacctcatcagcactgtgcaggctaactgtgctcaggatgtgtt
catgacggtggccaggacgatcttcacagatggcattaactggggacgaatcgtggctctgtttcatctggcctatcagc
ttatttataatgcactgactcaaaaccacttagaaatcatcaataacatcattagctgggtattacagtatatcaggcag
cacgtatccgcctggatcagacagcagggaggatgggaaggggttatccgcagcgtgtcgagatggcgcaccgtgaccgt
gatcgctgctgtagcattcatcgctgctgctgtatactggaaacgaagtcgctga
>gnl|bcl2dbcds|W5KJ41_BAX-01 BCL2-associated X gene OS=[Eukaryota] Astyanax mexicanus GN=BAX (length=648 residues).
atggcagattccggagacagcggggggaatgaggacagtgagctgttaggagctacaggtggagaagatgttgtagacga
ccaaatcgtagaacaaggcgcaatagtactgagagggtatgttcttcggcggctcagtacagagaaccctgatgtacgtg
tgagttgggtggaccttggtggaagacctgatgaaggcgatgaccctcaaataaaagtggttgtggagcagcttcttaga
attgctgatgatctgaatcgcaatactgagcttcaacacctcatcagcactgtgcaggctaactgtgctcaggatgtgtt
catgacggtggccaggacgatcttcacagatggcattaactggggacgaatcgtggctctgtttcatctggcctatcagc
ttatttataatatcccagagaagttgagaccatttctgaacatggcactgactcaaaaccacttagaaatcatcaataac
atcattagctgggtattacagtatatcaggcagcacgtatccgcctggatcagacagcagggaggatgggaaggggttat
ccgcagcgtgtcgagatggcgcaccgtgaccgtgatcgctgctgtagcattcatcgctgctgctgtatactggaaacgaa
gtcgctga
© 1998-2018