Dataset for CDS BAX-like of Organism Astyanax mexicanus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|W5KCK0_BAX-01 BCL2-associated X gene OS=[Eukaryota] Astyanax mexicanus GN=BAX (length=573 residues).
atgtttgtatgttctgtgttcaaaggcaacggtaatgaacaactgttagacctgggagcttccctgctaaaagattttat
ctaccaacgggttcagcgtcatggggacagcaatgctttggtgacaaggaaccagttgggcgggacagagttgtgtgacc
cgagccataagagacttgcgcagtgtcttcagcagattggagacgagttagacagcaatgtacagctgcagagtatgata
aatgactcggcgctacagcccacccaagacgtgtttgtgaaagtggcttgtgaaatcttctctgatgggaagtttaactg
gggcagggtggtggcgcttttctattttgcttgtcgactcgtcatcaaggctgtgctgactaagcttcctgacatcatca
gaaccatcatcaattggaccgtagactacctgcgggaacatgtgattaattggatcagggaacagggaggctgggaaggt
atccggtcctactttggaacccctacctggcaaactgttggcgtctttctggctggagtgctcaccactgtgctggtcat
gcgcaaaatgtga
>gnl|bcl2dbcds|W5KF74_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Astyanax mexicanus GN=BOK (length=687 residues).
atggatttgatggatcgaggcccgagtgagaaggagctggttttccagtctaagatactgtgcagagacttcatttactc
caggatcaccagagaaggtctcaactggtccaaagttgaatcgtccctgcctgtaccagttccagacggagctcttggag
atgtctccatggtgcttctaaagcttggtgatgagctggagtacatgcggccgtatatctacaggaacgtggcgaagcag
ctcagtatatcggtgtctgtggagagcgtggtgtcggacgcttttctctctgtggcgacggagatcctctccctggggat
cacgtgggggaaggtggtggccatctttgcagtagctggggggtctggcggtggactgtgtccggcagggtcatccagcc
atgatactcactatagtggacagcctgggggagttcgtccggaagagcctggtgccctggctgaagaggagaggaggctg
gggagacatttcaaagtgtgtgacgagcgtggacactacacctccgtcccattggatgtctgcagtagtatcaacctgga
ggcacgttgtgaagaccatgtatatctacctgatgaagtaactgtggaagcagtagctgttaatacggctccaggactgg
aattactgggaagtctcagactgctcatgatctcagagctttactaa
© 1998-2019