Dataset for CDS BAX of Organism Astyanax mexicanus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|W5KCK0_BAX-01 BCL2-associated X gene OS=[Eukaryota] Astyanax mexicanus GN=BAX (length=582 residues).
tttttaaatcaccaaggaagtggaggatcaacgtacagaagtgttaatctgctacgcataggatataggctactgataaa
ctttatctctgagcgtcttcagcgcacattggaaattgatgctgcagtaaccaaaaacctgttggacgagacggaagagg
tgcctgatcccaacattaagaaagttggacagcgtctacagcagtttggagatgaactggacaatgacacagaattgaaa
aatatgataaatgactcggcgctacagcccacccaagacgtgtttgtgaaagtggcttgtgaaatcttctctgatgggaa
gtttaactggggcagggtggtggcgcttttctattttgcttgtcgactcgtcatcaaggctgtgctgactaagcttcctg
acatcatcagaaccatcatcaattggaccgtagactacctgcgggaacatgtgattaattggatcagggaacagggaggc
tgggaaggtatccggtcctactttggaacccctacctggcaaactgttggcgtctttctggctggagtgctcaccactgt
gctggtcatgcgcaaaatgtga
>gnl|bcl2dbcds|W5KCL0_BAX-01 BCL2-associated X gene OS=[Eukaryota] Astyanax mexicanus GN=BAX (length=318 residues).
atgattaataacctaatgcccacaaaagaagtgttcctgaaaatcgcctatgaaatcttctctgactggaagtttaactg
gggcagggtggtggcactgttctactttgcttgtgagtttgtcaagatggttcctgatatcatcagtaacatcatcagct
ggactctagaattcatgcgtgatcatgtgattgcatggatcagtggacagggaggctgggacgcaatcctctcacagatt
gaagcaccttcctggacaactgtcactgcatttgtggctggagttctcactactgctctcatcgtaaacaaaatgtga
>gnl|bcl2dbcds|W5KJ41_BAX-02 BCL2-associated X gene OS=[Eukaryota] Astyanax mexicanus GN=BAX (length=615 residues).
atggcagattccggagacagcggggggaatgaggacagtgagctgttaggagctacaggtggagaagatgttgtagacga
ccaaatcgtagaacaaggcgcaatagtactgagagggtatgttcttcggcggctcagtacagagaaccctgatgtacgtg
tgagttgggtggaccttggtggaagacctgatgaaggcgatgaccctcaaataaaagtggttgtggagcagcttcttaga
attgctgatgatctgaatcgcaatactgagcttcaacacctcatcagcactgtgcaggctaactgtgctcaggatgtgtt
catgacggtggccaggacgatcttcacagatggcattaactggggacgaatcgtggctctgtttcatctggcctatcagc
ttatttataatgcactgactcaaaaccacttagaaatcatcaataacatcattagctgggtattacagtatatcaggcag
cacgtatccgcctggatcagacagcagggaggatgggaaggggttatccgcagcgtgtcgagatggcgcaccgtgaccgt
gatcgctgctgtagcattcatcgctgctgctgtatactggaaacgaagtcgctga
>gnl|bcl2dbcds|W5KJ41_BAX-01 BCL2-associated X gene OS=[Eukaryota] Astyanax mexicanus GN=BAX (length=648 residues).
atggcagattccggagacagcggggggaatgaggacagtgagctgttaggagctacaggtggagaagatgttgtagacga
ccaaatcgtagaacaaggcgcaatagtactgagagggtatgttcttcggcggctcagtacagagaaccctgatgtacgtg
tgagttgggtggaccttggtggaagacctgatgaaggcgatgaccctcaaataaaagtggttgtggagcagcttcttaga
attgctgatgatctgaatcgcaatactgagcttcaacacctcatcagcactgtgcaggctaactgtgctcaggatgtgtt
catgacggtggccaggacgatcttcacagatggcattaactggggacgaatcgtggctctgtttcatctggcctatcagc
ttatttataatatcccagagaagttgagaccatttctgaacatggcactgactcaaaaccacttagaaatcatcaataac
atcattagctgggtattacagtatatcaggcagcacgtatccgcctggatcagacagcagggaggatgggaaggggttat
ccgcagcgtgtcgagatggcgcaccgtgaccgtgatcgctgctgtagcattcatcgctgctgctgtatactggaaacgaa
gtcgctga
© 1998-2018