Dataset for CDS BAX of Organism Astyanax mexicanus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W5KCK0_BAX-01 BCL2-associated X gene OS=[Eukaryota] Astyanax mexicanus GN=BAX (length=573 residues).
atgtttgtatgttctgtgttcaaaggcaacggtaatgaacaactgttagacctgggagcttccctgctaaaagattttat
ctaccaacgggttcagcgtcatggggacagcaatgctttggtgacaaggaaccagttgggcgggacagagttgtgtgacc
cgagccataagagacttgcgcagtgtcttcagcagattggagacgagttagacagcaatgtacagctgcagagtatgata
aatgactcggcgctacagcccacccaagacgtgtttgtgaaagtggcttgtgaaatcttctctgatgggaagtttaactg
gggcagggtggtggcgcttttctattttgcttgtcgactcgtcatcaaggctgtgctgactaagcttcctgacatcatca
gaaccatcatcaattggaccgtagactacctgcgggaacatgtgattaattggatcagggaacagggaggctgggaaggt
atccggtcctactttggaacccctacctggcaaactgttggcgtctttctggctggagtgctcaccactgtgctggtcat
gcgcaaaatgtga
© 1998-2019