Dataset for CDS BOK of Organism Astatotilapia calliptera

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A3P8R3S9_BOK-03 BCL2-related ovarian killer gene OS=[Eukaryota] Astatotilapia calliptera GN=BOK (length=669 residues).
atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgtgtttgaccgatcactgaccgagaaggagct
ggtgacccagtctaaggcgctgtgcagagactacatcttgtcgaggctcaaccaaaacgggttgggatggtctaaaactg
aactcaatttttctccctcaaacacagcgctggctgaagtgtctatggtgcttctctgtcttggcgatgagctggagtgt
atacagcccagtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatggagaacatggtttcggatgcctt
catcggtgtagcaacagagattttctcagcaggcataacatggggtaaggtggtgtccatgtttgcggtagctggagccc
tggcagtggactgtgtcagacaaggccatccggctacagtgcacatcttagtggacagtctgggacagtttgtccgcaaa
ttcctggttccctggctgaagcgacggggaggatgggtaagtttctgcctcagcaaaattttgggcaaacatgaaatgca
taaaaagttgacatttgagatacaacagcgatttgcatttgctagttttgtgtgtgtgtgtgcaggggtggggtggggat
ttgaatttgatgcactgctttgtgcatga
>gnl|bcl2dbcds|A0A3P8R3S9_BOK-06 BCL2-related ovarian killer gene OS=[Eukaryota] Astatotilapia calliptera GN=BOK (length=669 residues).
atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgtgtttgaccgatcactgaccgagaaggagct
ggtgacccagtctaaggcgctgtgcagagactacatcttgtcgaggctcaaccaaaacgggttgggatggtctaaaactg
aactcaatttttctccctcaaacacagcgctggctgaagtgtctatggtgcttctctgtcttggcgatgagctggagtgt
atacagcccagtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatggagaacatggtttcggatgcctt
catcggtgtagcaacagagattttctcagcaggcataacatggggtaaggtggtgtccatgtttgcggtagctggagccc
tggcagtggactgtgtcagacaaggccatccggctacagtgcacatcttagtggacagtctgggacagtttgtccgcaaa
ttcctggttccctggctgaagcgacggggaggatgggtaagtttctgcctcagcaaaattttgggcaaacatgaaatgca
taaaaagttgacatttgagatacaacagcgatttgcatttgctagttttgtgtgtgtgtgtgcaggggtggggtggggat
ttgaatttgatgcactgctttgtgcatga
>gnl|bcl2dbcds|A0A3P8R3S9_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Astatotilapia calliptera GN=BOK (length=669 residues).
atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgtgtttgaccgatcactgaccgagaaggagct
ggtgacccagtctaaggcgctgtgcagagactacatcttgtcgaggctcaaccaaaacgggttgggatggtctaaaactg
aactcaatttttctccctcaaacacagcgctggctgaagtgtctatggtgcttctctgtcttggcgatgagctggagtgt
atacagcccagtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatggagaacatggtttcggatgcctt
catcggtgtagcaacagagattttctcagcaggcataacatggggtaaggtggtgtccatgtttgcggtagctggagccc
tggcagtggactgtgtcagacaaggccatccggctacagtgcacatcttagtggacagtctgggacagtttgtccgcaaa
ttcctggttccctggctgaagcgacggggaggatgggtaagtttctgcctcagcaaaattttgggcaaacatgaaatgca
taaaaagttgacatttgagatacaacagcgatttgcatttgctagttttgtgtgtgtgtgtgcaggggtggggtggggat
ttgaatttgatgcactgctttgtgcatga
>gnl|bcl2dbcds|A0A3P8R3S9_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Astatotilapia calliptera GN=BOK (length=669 residues).
atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgtgtttgaccgatcactgaccgagaaggagct
ggtgacccagtctaaggcgctgtgcagagactacatcttgtcgaggctcaaccaaaacgggttgggatggtctaaaactg
aactcaatttttctccctcaaacacagcgctggctgaagtgtctatggtgcttctctgtcttggcgatgagctggagtgt
atacagcccagtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatggagaacatggtttcggatgcctt
catcggtgtagcaacagagattttctcagcaggcataacatggggtaaggtggtgtccatgtttgcggtagctggagccc
tggcagtggactgtgtcagacaaggccatccggctacagtgcacatcttagtggacagtctgggacagtttgtccgcaaa
ttcctggttccctggctgaagcgacggggaggatgggtaagtttctgcctcagcaaaattttgggcaaacatgaaatgca
taaaaagttgacatttgagatacaacagcgatttgcatttgctagttttgtgtgtgtgtgtgcaggggtggggtggggat
ttgaatttgatgcactgctttgtgcatga
>gnl|bcl2dbcds|A0A3P8R3S9_BOK-05 BCL2-related ovarian killer gene OS=[Eukaryota] Astatotilapia calliptera GN=BOK (length=669 residues).
atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgtgtttgaccgatcactgaccgagaaggagct
ggtgacccagtctaaggcgctgtgcagagactacatcttgtcgaggctcaaccaaaacgggttgggatggtctaaaactg
aactcaatttttctccctcaaacacagcgctggctgaagtgtctatggtgcttctctgtcttggcgatgagctggagtgt
atacagcccagtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatggagaacatggtttcggatgcctt
catcggtgtagcaacagagattttctcagcaggcataacatggggtaaggtggtgtccatgtttgcggtagctggagccc
tggcagtggactgtgtcagacaaggccatccggctacagtgcacatcttagtggacagtctgggacagtttgtccgcaaa
ttcctggttccctggctgaagcgacggggaggatgggtaagtttctgcctcagcaaaattttgggcaaacatgaaatgca
taaaaagttgacatttgagatacaacagcgatttgcatttgctagttttgtgtgtgtgtgtgcaggggtggggtggggat
ttgaatttgatgcactgctttgtgcatga
>gnl|bcl2dbcds|A0A3P8R3S9_BOK-04 BCL2-related ovarian killer gene OS=[Eukaryota] Astatotilapia calliptera GN=BOK (length=642 residues).
atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgtgtttgaccgatcactgaccgagaaggagct
ggtgacccagtctaaggcgctgtgcagagactacatcttgtcgaggctcaaccaaaacgggttgggatggtctaaaactg
aactcaatttttctccctcaaacacagcgctggctgaagtgtctatggtgcttctctgtcttggcgatgagctggagtgt
atacagcccagtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatggagaacatggtttcggatgcctt
catcggtgtagcaacagagattttctcagcaggcataacatggggtaaggtggtgtccatgtttgcggtagctggagccc
tggcagtggactgtgtcagacaaggccatccggctacagtgcacatcttagtggacagtctgggacagtttgtccgcaaa
ttcctggttccctggctgaagcgacggggaggatgggtggagatcacaaaatgtgtggtgaaaaaggatttttgccctga
agaaaactggctgtcctctgcctttgagtccctcaagtgcttcctcacgacgatgtatgtctacatcatgaaggagccgt
ga
>gnl|bcl2dbcds|A0A3P8R8S7_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Astatotilapia calliptera GN=BOK (length=633 residues).
atggagatgttgcgtcgctcctctgtgtttgcctctgaagtgtttgaccgctcgcccaccgacaaggagctggtgtccca
agccaaagcactgtgcagggaatacatccactccaggctgaaccgtgccgggatcggctggtccaagcctgaacacggac
tggctgcgtcaggtgggacactgggagagatatcttcggtcctgctgtggctgggcgatgagttggagtaccttcgtccc
aatgtgtaccgtaacgtcgcccgccagctgaacatcacagtggcatcggagagcgtggtgtccgacgccttcctggctgt
cgctgcagacattttctccacaggtgtgacatggggaaaggtggtttccttgtacgctgtagcgggagccttggcggtgg
actgtgtacgccatggtcatccagcaatggtccataccattgtcgactgcatgggggagtttgtccgcaagagcctgact
tcctggttaaaaaagagaggaggctgggtggatgtaacaaagtgcgtggtgagcactgacccaaacttctgttcgcactg
gctggtgtctgctgtctgtgcctttggacactacctgaagacggtcgtgctacacctcctccgcgagaagtga
© 1998-2019