Dataset for CDS BAX-like of Organism Astatotilapia calliptera

[Download (right click)] [Alignment] [Repertoires]

13 sequence(s)

>gnl|bcl2dbcds|A0A3P8N5H5_BAX-01 BCL2-associated X gene OS=[Eukaryota] Astatotilapia calliptera GN=BAX (length=825 residues).
atgatggttcgtacggagtatctgaactgtggaagaacacaaagtaaaacagataaatactcctctgtgggcaggtttct
gggcgagtatctccatctgtgggatttctgtgaggcgtgtctacggactgctggtcccgtcgctacgatacttccgtatc
acttccgtgtgcttctgttgaaaggcgggtttccacagactaggtttggctccatggctgacggccgaggggggcagaat
ccggagcaggagccgaggggcgccgcgggtggagacgatgtcgttgatgattccatcctcgaagaaggtgcggttgtctt
tagagggtatgtgattgcacatataaacacagaggagcccagtcgacacgtgacttctgaggatttgggaggaaggccag
atgaacaacaggatccacaagtcaaagaagtggtagaacagctgcgcaagatagccgacagtttaaaccgcaatgctgag
cttcagagactgataaaccaggttcaggggaactgcgttcaagatgtcttcatggcagttgcaagaaacatctttgctga
tggcatcaactggggtcgagtagtggctctcttccatctggcctgtaaacttatacacaaggctattaccgccaatcact
tagagaacatccaaatgatcatcagctgggtcctccaggtcatcagggagcaggtctacagctggcttgtggcacaaggg
ggctgggagggggtgatccgtggtttctctcgatggaggacagcagccatggtagcatcagtagtattggtggtagcctt
tgtttactaccggaaagtacgataa
>gnl|bcl2dbcds|A0A3P8N5H5_BAX-02 BCL2-associated X gene OS=[Eukaryota] Astatotilapia calliptera GN=BAX (length=612 residues).
atggctgacggccgaggggggcagaatccggagcaggagccgaggggcgccgcgggtggagacgatgtcgttgatgattc
catcctcgaagaaggtgcggttgtctttagagggtatgtgattgcacatataaacacagaggagcccagtcgacacgtga
cttctgaggatttgggaggaaggccagatgaacaacaggatccacaagtcaaagaagtggtagaacagctgcgcaagata
gccgacagtttaaaccgcaatgctgagcttcagagactgataaaccaggttcaggggaactgcgttcaagatgtcttcat
ggcagttgcaagaaacatctttgctgatggcatcaactggggtcgagtagtggctctcttccatctggcctgtaaactta
tacacaaggctattaccgccaatcacttagagaacatccaaatgatcatcagctgggtcctccaggtcatcagggagcag
gtctacagctggcttgtggcacaagggggctgggagggggtgatccgtggtttctctcgatggaggacagcagccatggt
agcatcagtagtattggtggtagcctttgtttactaccggaaagtacgataa
>gnl|bcl2dbcds|A0A3P8NNI6_BAX-01 BCL2-associated X gene OS=[Eukaryota] Astatotilapia calliptera GN=BAX (length=618 residues).
atggcatcacacccaggaggaggcgatcaaggtagtagcagctatcgtcaacaaataaaatacatatatttcgactctga
cagtgtcggtgggagtccgatagacacagataatgtggctttcatctatgagcgagttcagaggcaaggagatggcaata
aggcagtgacgagagaacagcttggtggaagccagctgactgacccaaaacataagaagcttgctcagtgcctgcagcag
attggagacgagctggatggaaatgtagagctccaaagaatgataaatgactcttcgctttgtcccacaagagaggtttt
tatgagagtggcctatgagatcttttcagatggaatatttaactggggcagggtggttgcactgttctactttgcatgcc
gactcgttatcaaagctcttgtaactcagattccggatattatcagaaccattatcagttggaccatagactatctccgg
gaacatgtgatcaactggatcagggagcaaggtggctgggagggtattcgctcctactttggcacaccaacatggcagac
ggtcggagttttcttggcaggagtccttaccactgttcttgtcattcgcaagatgtga
>gnl|bcl2dbcds|A0A3P8NNI6_BAX-02 BCL2-associated X gene OS=[Eukaryota] Astatotilapia calliptera GN=BAX (length=579 residues).
atggcatcacacccaggaggaggcgatcaagggaattccggagatcagatactggaagtcggaactattttgttacagga
tttcatctatgagcgagttcagaggcaaggagatggcaataaggcagtgacgagagaacagcttggtggaagccagctga
ctgacccaaaacataagaagcttgctcagtgcctgcagcagattggagacgagctggatggaaatgtagagctccaaaga
atgataaatgactcttcgctttgtcccacaagagaggtttttatgagagtggcctatgagatcttttcagatggaatatt
taactggggcagggtggttgcactgttctactttgcatgccgactcgttatcaaagctcttgtaactcagattccggata
ttatcagaaccattatcagttggaccatagactatctccgggaacatgtgatcaactggatcagggagcaaggtggctgg
gagggtattcgctcctactttggcacaccaacatggcagacggtcggagttttcttggcaggagtccttaccactgttct
tgtcattcgcaagatgtga
>gnl|bcl2dbcds|A0A3P8NNI6_BAX-03 BCL2-associated X gene OS=[Eukaryota] Astatotilapia calliptera GN=BAX (length=603 residues).
atgcttatttatcagcatttgagtcatctaatgagtgtctacctttgtctttcagggaattccggagatcagatactgga
agtcggaactattttgttacaggatttcatctatgagcgagttcagaggcaaggagatggcaataaggcagtgacgagag
aacagcttggtggaagccagctgactgacccaaaacataagaagcttgctcagtgcctgcagcagattggagacgagctg
gatggaaatgtagagctccaaagaatgataaatgactcttcgctttgtcccacaagagaggtttttatgagagtggccta
tgagatcttttcagatggaatatttaactggggcagggtggttgcactgttctactttgcatgccgactcgttatcaaag
ctcttgtaactcagattccggatattatcagaaccattatcagttggaccatagactatctccgggaacatgtgatcaac
tggatcagggagcaaggtggctgggagggtattcgctcctactttggcacaccaacatggcagacggtcggagttttctt
ggcaggagtccttaccactgttcttgtcattcgcaagatgtga
>gnl|bcl2dbcds|A0A3P8NNW3_BAX-01 BCL2-associated X gene OS=[Eukaryota] Astatotilapia calliptera GN=BAX (length=498 residues).
atgcttatttatcagcatttgagtcatctaatgagtgtctacctttgtctttcatggaattccggagatcagatactgga
agtcggaactattttgttacaggatttcatctatgagcgagttcagaggcaaagagatggcaatagtgcagtgacgagag
aacagcttgatggaagccagctgactgacccaaaacataagaagcttgctcagtgcctgcagcatattggagacgagctg
gatggaaatgtagagctccaaagaatgataaataactcttcgctttgtcccacaagaaaggtttttatgagagtggcctc
tgagatcttttcagatggaatatttaactggggcagggtggttgcactgttctactttgcatgccgactcgttatcaaag
tacgtgaaactgctattgccgattccccctttgaatgggttttggattttgtacgtgttttgaattttgtacgtgttttg
gattttgcaacggtataa
>gnl|bcl2dbcds|A0A3P8R3S9_BOK-03 BCL2-related ovarian killer gene OS=[Eukaryota] Astatotilapia calliptera GN=BOK (length=669 residues).
atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgtgtttgaccgatcactgaccgagaaggagct
ggtgacccagtctaaggcgctgtgcagagactacatcttgtcgaggctcaaccaaaacgggttgggatggtctaaaactg
aactcaatttttctccctcaaacacagcgctggctgaagtgtctatggtgcttctctgtcttggcgatgagctggagtgt
atacagcccagtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatggagaacatggtttcggatgcctt
catcggtgtagcaacagagattttctcagcaggcataacatggggtaaggtggtgtccatgtttgcggtagctggagccc
tggcagtggactgtgtcagacaaggccatccggctacagtgcacatcttagtggacagtctgggacagtttgtccgcaaa
ttcctggttccctggctgaagcgacggggaggatgggtaagtttctgcctcagcaaaattttgggcaaacatgaaatgca
taaaaagttgacatttgagatacaacagcgatttgcatttgctagttttgtgtgtgtgtgtgcaggggtggggtggggat
ttgaatttgatgcactgctttgtgcatga
>gnl|bcl2dbcds|A0A3P8R3S9_BOK-06 BCL2-related ovarian killer gene OS=[Eukaryota] Astatotilapia calliptera GN=BOK (length=669 residues).
atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgtgtttgaccgatcactgaccgagaaggagct
ggtgacccagtctaaggcgctgtgcagagactacatcttgtcgaggctcaaccaaaacgggttgggatggtctaaaactg
aactcaatttttctccctcaaacacagcgctggctgaagtgtctatggtgcttctctgtcttggcgatgagctggagtgt
atacagcccagtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatggagaacatggtttcggatgcctt
catcggtgtagcaacagagattttctcagcaggcataacatggggtaaggtggtgtccatgtttgcggtagctggagccc
tggcagtggactgtgtcagacaaggccatccggctacagtgcacatcttagtggacagtctgggacagtttgtccgcaaa
ttcctggttccctggctgaagcgacggggaggatgggtaagtttctgcctcagcaaaattttgggcaaacatgaaatgca
taaaaagttgacatttgagatacaacagcgatttgcatttgctagttttgtgtgtgtgtgtgcaggggtggggtggggat
ttgaatttgatgcactgctttgtgcatga
>gnl|bcl2dbcds|A0A3P8R3S9_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Astatotilapia calliptera GN=BOK (length=669 residues).
atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgtgtttgaccgatcactgaccgagaaggagct
ggtgacccagtctaaggcgctgtgcagagactacatcttgtcgaggctcaaccaaaacgggttgggatggtctaaaactg
aactcaatttttctccctcaaacacagcgctggctgaagtgtctatggtgcttctctgtcttggcgatgagctggagtgt
atacagcccagtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatggagaacatggtttcggatgcctt
catcggtgtagcaacagagattttctcagcaggcataacatggggtaaggtggtgtccatgtttgcggtagctggagccc
tggcagtggactgtgtcagacaaggccatccggctacagtgcacatcttagtggacagtctgggacagtttgtccgcaaa
ttcctggttccctggctgaagcgacggggaggatgggtaagtttctgcctcagcaaaattttgggcaaacatgaaatgca
taaaaagttgacatttgagatacaacagcgatttgcatttgctagttttgtgtgtgtgtgtgcaggggtggggtggggat
ttgaatttgatgcactgctttgtgcatga
>gnl|bcl2dbcds|A0A3P8R3S9_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Astatotilapia calliptera GN=BOK (length=669 residues).
atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgtgtttgaccgatcactgaccgagaaggagct
ggtgacccagtctaaggcgctgtgcagagactacatcttgtcgaggctcaaccaaaacgggttgggatggtctaaaactg
aactcaatttttctccctcaaacacagcgctggctgaagtgtctatggtgcttctctgtcttggcgatgagctggagtgt
atacagcccagtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatggagaacatggtttcggatgcctt
catcggtgtagcaacagagattttctcagcaggcataacatggggtaaggtggtgtccatgtttgcggtagctggagccc
tggcagtggactgtgtcagacaaggccatccggctacagtgcacatcttagtggacagtctgggacagtttgtccgcaaa
ttcctggttccctggctgaagcgacggggaggatgggtaagtttctgcctcagcaaaattttgggcaaacatgaaatgca
taaaaagttgacatttgagatacaacagcgatttgcatttgctagttttgtgtgtgtgtgtgcaggggtggggtggggat
ttgaatttgatgcactgctttgtgcatga
>gnl|bcl2dbcds|A0A3P8R3S9_BOK-05 BCL2-related ovarian killer gene OS=[Eukaryota] Astatotilapia calliptera GN=BOK (length=669 residues).
atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgtgtttgaccgatcactgaccgagaaggagct
ggtgacccagtctaaggcgctgtgcagagactacatcttgtcgaggctcaaccaaaacgggttgggatggtctaaaactg
aactcaatttttctccctcaaacacagcgctggctgaagtgtctatggtgcttctctgtcttggcgatgagctggagtgt
atacagcccagtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatggagaacatggtttcggatgcctt
catcggtgtagcaacagagattttctcagcaggcataacatggggtaaggtggtgtccatgtttgcggtagctggagccc
tggcagtggactgtgtcagacaaggccatccggctacagtgcacatcttagtggacagtctgggacagtttgtccgcaaa
ttcctggttccctggctgaagcgacggggaggatgggtaagtttctgcctcagcaaaattttgggcaaacatgaaatgca
taaaaagttgacatttgagatacaacagcgatttgcatttgctagttttgtgtgtgtgtgtgcaggggtggggtggggat
ttgaatttgatgcactgctttgtgcatga
>gnl|bcl2dbcds|A0A3P8R3S9_BOK-04 BCL2-related ovarian killer gene OS=[Eukaryota] Astatotilapia calliptera GN=BOK (length=642 residues).
atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgtgtttgaccgatcactgaccgagaaggagct
ggtgacccagtctaaggcgctgtgcagagactacatcttgtcgaggctcaaccaaaacgggttgggatggtctaaaactg
aactcaatttttctccctcaaacacagcgctggctgaagtgtctatggtgcttctctgtcttggcgatgagctggagtgt
atacagcccagtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatggagaacatggtttcggatgcctt
catcggtgtagcaacagagattttctcagcaggcataacatggggtaaggtggtgtccatgtttgcggtagctggagccc
tggcagtggactgtgtcagacaaggccatccggctacagtgcacatcttagtggacagtctgggacagtttgtccgcaaa
ttcctggttccctggctgaagcgacggggaggatgggtggagatcacaaaatgtgtggtgaaaaaggatttttgccctga
agaaaactggctgtcctctgcctttgagtccctcaagtgcttcctcacgacgatgtatgtctacatcatgaaggagccgt
ga
>gnl|bcl2dbcds|A0A3P8R8S7_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Astatotilapia calliptera GN=BOK (length=633 residues).
atggagatgttgcgtcgctcctctgtgtttgcctctgaagtgtttgaccgctcgcccaccgacaaggagctggtgtccca
agccaaagcactgtgcagggaatacatccactccaggctgaaccgtgccgggatcggctggtccaagcctgaacacggac
tggctgcgtcaggtgggacactgggagagatatcttcggtcctgctgtggctgggcgatgagttggagtaccttcgtccc
aatgtgtaccgtaacgtcgcccgccagctgaacatcacagtggcatcggagagcgtggtgtccgacgccttcctggctgt
cgctgcagacattttctccacaggtgtgacatggggaaaggtggtttccttgtacgctgtagcgggagccttggcggtgg
actgtgtacgccatggtcatccagcaatggtccataccattgtcgactgcatgggggagtttgtccgcaagagcctgact
tcctggttaaaaaagagaggaggctgggtggatgtaacaaagtgcgtggtgagcactgacccaaacttctgttcgcactg
gctggtgtctgctgtctgtgcctttggacactacctgaagacggtcgtgctacacctcctccgcgagaagtga
© 1998-2019