Dataset for CDS BOK of Organism Aotus nancymaae

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2K5DQ30_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Aotus nancymaae GN=BOK (length=606 residues).
atggaggtgctgcgccgctcctccgtcttcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccagccaaagtacgtgcacgcgcggctgctcgcgcccgagcgcgccgcgccgtccgggcgccctgccgaggtcg
tggcggccctacaggcagcacccgggcgggacgagctggagatgatccggcccagcgtctaccgcaacgtggcgcgccag
ctgcacatctccctacagtctgagcccgtggtgaccgacgcgttcctggccgtggccggccacatcttctctgcaggcat
cacgtggggcaaggtggtgtccctgtacgcggtggccgcagggctggccgtggactgcgtgaggcaggcccagcctgcca
tggtccacgcccttgtcgactgcctgggagagtttgtacgcaagaccctggccacctggctgcggaggcgcggtggatgg
actgatgtcctcaagtgtgtggtcagcaccgaccccggcctccgctcccactggctgctcgccgcactgtgcagcttcgg
ccgcttcctgaaggctgccttcttcgtgctcctgccagagagatga
© 1998-2018