Dataset for CDS BAX of Organism Aotus nancymaae

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A2K5D885_BAX-02 BCL2-associated X gene OS=[Eukaryota] Aotus nancymaae GN=BAX (length=519 residues).
atggacgggtccggggagcagcccagaggcgagggtgagtttcatccaggatcgagcaggacacccgagctggccctgga
cccggtgccccaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgagctggacagtaacatgg
agctgcagaggatgattgccgctgtggacacagactccccccgagaggtcttttttcgagtggcagctgacatgttctct
gacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtgccaa
ggtgcccgagctgatcagaaccatcatgggctggactttggacttccttcgggagcggctgttgggctggatccaagacc
agggtggttgggatggcctcctctcctacttctttgggacacccacgtggcagacagtgaccatctttgtggctggagtg
ctcactgcctcgcttaccatctggaagaacatgggctga
>gnl|bcl2dbcds|A0A2K5D885_BAX-01 BCL2-associated X gene OS=[Eukaryota] Aotus nancymaae GN=BAX (length=582 residues).
atggacgggtccggggagcagcccagaggcgaggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatcgggggggagacacccgagctggccctggacccggtgccccaggatg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgagctggacagtaacatggagctgcagaggatgatt
gccgctgtggacacagactccccccgagaggtcttttttcgagtggcagctgacatgttctctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtgccaaggtgcccgagctgatca
gaaccatcatgggctggactttggacttccttcgggagcggctgttgggctggatccaagaccagggtggttgggatggc
ctcctctcctacttctttgggacacccacgtggcagacagtgaccatctttgtggctggagtgctcactgcctcgcttac
catctggaagaacatgggctga
>gnl|bcl2dbcds|A0A2K5D885_BAX-03 BCL2-associated X gene OS=[Eukaryota] Aotus nancymaae GN=BAX (length=435 residues).
atggacgggtccggggagcagcccagaggcgaggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcaggggatgattgccgctgtggacacagactccccccgagaggtcttttttcgagtggcagctgacatgttctctgacg
gcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtgccaaggtg
cccgagctgatcagaaccatcatgggctggactttggacttccttcgggagcggctgttgggctggatccaagaccaggg
tggttgggatggcctcctctcctacttctttgggacacccacgtggcagacagtgaccatctttgtggctggagtgctca
ctgcctcgcttaccatctggaagaacatgggctga
>gnl|bcl2dbcds|A0A2K5D885_BAX-04 BCL2-associated X gene OS=[Eukaryota] Aotus nancymaae GN=BAX (length=531 residues).
atggacgggtccggggagcagcccagaggcgaggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatcgggggggagacacccgagctggccctggacccggtgccccaggatg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgagctggacagtaacatggagctgcagaggatgatt
gccgctgtggacacagactccccccgagaggtcttttttcgagtggcagctgacatgttctctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtgccaaggtgcccgagctgatca
gaaccatcatgggctggactttggacttccttcgggagcggctgttgggctggatccaagaccagggtggttgggtcaca
ctgcttcccctgcccatcttcagatcatcagatgtggtctctaatgcattt
© 1998-2018