Dataset for CDS BOK of Organism Anolis carolinensis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G1K8X4_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Anolis carolinensis GN=BOK (length=648 residues).
atgaagatggatgtactgcgccgctcctctgtcttcgctgcagaagtgatggaagtgtttgaccggacacccaccgacaa
ggagcttgtgtctcaggccaaagtgctgtgcagagacttcatccactcccggctcatacgggctggcattggctggaaca
agcctgaacacagcgtgcctgttcccgggggcaagttagcagaggtatccaacatacttctcagattaggtgatgagctg
gagtacattaggcccaacctttaccggaacgtagcgcgacagctgaacatttctttgcactctgaaacagtggtgacgga
tgcattcctggcggtggcaacgcagatcttttcttcaggcataacatggggcaagattgtgtctctctatgctgtggcag
ctggccttgctgtggactgtgtgcgacatgctcagccagccatggttcatactattgtggattgcttgggagagtttgta
cgcaagaccttggtgacctggatgaagagaagaggaggctggagtgacataacaaaatgtgtggtgaatactgatcccaa
cctccgctctcattggcttgtggctgccatttgtagctttggccacttcctgaaggccatcttctttgtgctgttaccag
aaagatga
© 1998-2018