Dataset for CDS BAK1 of Organism Anolis carolinensis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G1KSN2_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Anolis carolinensis GN=BAK1 (length=645 residues).
atggcctcaagaaatggcaacgacccaacagacaggaggaggacagagatacgcagaccatccatggaaattgcattaga
agaccaggtggctcaggagacggaggaggtgttccagagctacgctttctaccggtatcaacaggagcgggagcagactg
agggggatgtgccacatgacccagaaatagctgcgatcccgcatgagccaaatagcacaaattgccaggtgggcaggcgc
ctggccactattggtgatgacatcaatgcccgctatgacaaggagttctcggaaatgttgaagtcactccagccaacaaa
ggacaacgcctatgagtactttattagaatagccagcagtttgtttgaaagtggcataaactggggccgtgtgatagcac
tgttgggcttcggctacaggatggcgatccatgtataccagcatgggatgaccggcttcctgaggagaattgcccgctac
atggctgattttgtgcttcgcaaccgcattgcccggtggattgctcagcagggcggatgggtggcagcactggacttaag
caacgtgtacttgaagtatgtgctgatagtggcggctgtgatcttgctaggccagtttgtggtgcggcgtttcttcaacc
catga
© 1998-2018