Dataset for CDS BOK of Organism Anas platyrhynchos

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|U3ISP1_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Anas platyrhynchos GN=BOK (length=675 residues).
atggaagtgcttcgccgatcctcagtcttcgctgcagaggtgatggaggtgttcgacaggtctcccactgacaaggagct
tgtgtcccaagctaaggctctctgcagagactacataaattcgaggctggttcgagcaggtgtcagctggagcaaacccg
agtgcaatgcgccggtgcctggcgggaagctggccgaagtgtccaccatcctgctgcggctgggagatgagctggaatac
attcgccccaacgtctaccggaacatcgcccgccagctgaacatctctctgcactcggagacggtggtgacggacgcctt
cctggctgtagccgcgcagattttcaccgcagagttcagaggaaagaggctcttaccaagcaaaggcataacgtggggca
aggtggtgtctctctacgcggtggcggcggggctggcagtggactgtgtgcggcacgcacagccagccatggtgcacacc
atcgttgactgcctgggagagttcgtccgcaagaccttggtgacctggctgaaaaggcgaggaggctgggcagacatcac
gaagtgtgttgtgaatactgaccccagccttcgctcccactggctcgtggctgctgtttgcagctttgggcacttcctca
aggcgatcttcttcgtgctgctgcctgagagatga
© 1998-2018