Dataset for CDS BAK1 of Organism Anas platyrhynchos

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|U3I5I2_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Anas platyrhynchos GN=BAK1 (length=654 residues).
atggcctcagggaacgacggagacccaccgagggcccacggacgccggggcagcaatgggcgcagactgtcacaagagct
caattcagaagaccaggtggctcaggaaaccgaggaggtgtttcggagctacgccttctaccgctaccaacaggagagag
aagagagcggggaagaagtgcccttggacccggagattgcggagatccagcaagacctgggcagtaccgggagcctggtg
ggaaggcgcctggccatcatcggcgatgacattaacaagcggtacgacgctgagtttcgctacatgctgaaatccttgca
gctcaccaaggagaatgcctacgattacttcatcaagattgcctccagcctgtttgaaagcggcattaactggggccggg
tgatcgcgctgctgggcttcggctactgcatggccatccacgtctaccagcacggcataacaggcttcctccgccgcatc
gcccgctacgtgacggagttcatgctgcgcaaccgcatcgcccagtggatcgcccagcagggaggatgggtggctgcact
cgatctggacaatgtttacatgaagtacatgctggcggtggtggccctggtgatggtggggcatttagtggtacgacgct
tcttcaggccctga
© 1998-2018