Dataset for CDS Unclassified of Organism Anabas testudineus

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A3Q1I0M1_uncBCLWAV-01 Putative BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Anabas testudineus (length=435 residues).
atgtgtcagtcagaggtgccagacaccagattgggcctgaacagtcctgacccactagtgagagaagcttttttgatggc
cgaccatatagactatgtatgtactgcagccttgcaccacactgtagatgagctcctcacacgtttccccatcttcttca
ggtgctggcctcgcatcttcaatgatgtgacagagaaaacatcttgccccatactcataagcatcctggatgagcacttc
tttccccaagtccttggggggaggtgcagggacctggcctggagtgcggtgctgtcagtctatgtgctggctggccagat
ggctctgcattatcacaggaggggcatgacagtggtcctgtcccagctgaaggagtgtgtgggggcctacatgaagaggg
tcatctgctctgagatacaagacaagggaggattg
>gnl|bcl2dbcds|A0A3Q1I2H2_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Anabas testudineus (length=603 residues).
atggcgtgtgaaggaaacggtctgtccgatgagaggataggggaagccctgatcagagaggtcatagaggaccagctgaa
agatataccctctgaggatgtcccacccctcactcccctggtgaaagtaaagaatgaccaggagcagaaggtggtggccc
agctggccgcaatggttcgcatcgttggagacaggatgcacacagacagagcgttccaggatgcaattgatgggattgct
agaaactcaaactccaagtgggacaaattcagggaagtggcagacaaagtgtttgaacatggaatcacctgggaaaggat
cgctgtgcttatctatgttgccggcaagctggctgtcaagatggtggaagcccatcttcctcagtcagtgagagagatcc
tgaagtggactgtggagtttttcaaaaacaatctcctgggctggatttgggaacatggtggatggatcagcagtttctcc
gagctagcaaagtcttccatgcagagcatgtcatgcatgggctctctcaactatggctgggtcttcatctttgtcgctgg
tctgggtttaggaagcttcatcacctggagactgaccagatga
© 1998-2019