Dataset for CDS BAX-like of Organism Anabas testudineus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A3Q1I4R6_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Anabas testudineus GN=BOK (length=642 residues).
atggaagtcctgcggcggtcttctgtctttgccgcagaggtcctggatgtctttgaccgatcgctgactgagaaagagct
ggtgtcccagtccaaagccttgtgcagggactacatcctgtccagactcaaccagaacgggctgggatggtccaaaactg
aactcaacctctccccatcaaatgcagctcttgctgatgtgtctttggtgcttctctgtctgggcgacgaactggagtgt
atacagcccagtttgtggaggaatgtggcgcggcagctcaacatctctgttgccatggagaacatggtttcagatgcttt
tatcggcgtggcaacggaaatcttctcaacaggtataacatggggtaaggtggtgtccatgtatgcagtagctggagccc
tggcagtcgactgtgtcagacaaggacatccgtccacagttcacataatagtggacagtctgggacagtttgtccgtagg
ttcctggttccctggctgaagagacgaggaggatgggcagagatctcaaaatgcgtggtgaagaaggatctcagtcctga
acaccactggttgtcctctgtcatcgagtcgctgaagtacttcctcaccacgatgtacgtctgcatcatgaaggaaccct
ga
>gnl|bcl2dbcds|A0A3Q1I5B7_BAX-01 BCL2-associated X gene OS=[Eukaryota] Anabas testudineus GN=BAX (length=618 residues).
atggctgacagccgagaagaggagaagaaagacggagacgaggagcctcagggcgccgtgggtggagaagatgttgtcga
tgattccatcatggagcaagcagcagtagtgctcagagggtttgtgattgagcgccttagcacagatgatcctggtcaac
aagtgtcccctgagcaactgggtggaaggccaaatgaacagcaggatccacagatcaaagacgtggtggaccagctgatc
aagattgcagaggaactgaacaggaacgccgaactccaacaactgatcaaccaggttcaaagtaactgtgcacatgacgt
cttcatgaccgtagtcaggagcatctttgctgatggcatcaactggggtcgagtggtggctctcttccatctggcctaca
ggctcatacacagggcactgaccaccaaccatctagacaacatcaggatggtctttaactggttccttgaggtcatcaga
gagctgctctactcctggctcgtacagcaaggaggctgggtgggggtgatccgtggcttctcccggtggaggacagtagc
catagcagcatcagtaatattagtggcgacctttgtttactacaggaagacacgctga
>gnl|bcl2dbcds|A0A3Q1I5B7_BAX-02 BCL2-associated X gene OS=[Eukaryota] Anabas testudineus GN=BAX (length=573 residues).
atggctgacagccgagaagaggagaagaaagacggagacgaggagcctcagggcgccgtgggtggagaaggtatgtttgt
gattgagcgccttagcacagatgatcctggtcaacaagtgtcccctgagcaactgggtggaaggccaaatgaacagcagg
atccacagatcaaagacgtggtggaccagctgatcaagattgcagaggaactgaacaggaacgccgaactccaacaactg
atcaaccaggttcaaagtaactgtgcacatgacgtcttcatgaccgtagtcaggagcatctttgctgatggcatcaactg
gggtcgagtggtggctctcttccatctggcctacaggctcatacacagggcactgaccaccaaccatctagacaacatca
ggatggtctttaactggttccttgaggtcatcagagagctgctctactcctggctcgtacagcaaggaggctgggtgggg
gtgatccgtggcttctcccggtggaggacagtagccatagcagcatcagtaatattagtggcgacctttgtttactacag
gaagacacgctga
>gnl|bcl2dbcds|A0A3Q1I9F7_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Anabas testudineus GN=BOK (length=633 residues).
atggagatgttgcgccgctcctcagtgtttgcggctgaagtgtttgaccgctcgcccaccgacaaggagttggtgtccca
ggccaaagcgctgtgcagggactacattcattccaggctgaaccgtgccgggataggctggtctaagcctgagcacggac
tggctgcatcaggtggggcactgggagagatctcctctgtgctgctgtggctgggggatgagttggagtacctgcgaccc
aacatttatcgtaacgtagcgcgacagctcaacatccctgtggcgtccgagggcgtggtgtcagatgctttcctggctgt
ggcagcagacattttctccacaggtgtgacgtggggaaaggtggtttctttgtacgccgtggcaggggccttagcagtgg
actgcgtccgccatggtcatccagctattgtccacaccatcgtcgactgtatgggagagtttgtccgcaagagtctgacc
tcctggttaaaaaagagagggggctgggtggatttaacaaaatgtgtggtgaacactgatcccagcttctgctctcactg
gctggtgtccgctgcctttgcctttggatattatctgaaggccatcgtgttacacctactcagagagaagtga
>gnl|bcl2dbcds|R9Y0N7_BAX-01 BCL2-associated X gene OS=[Eukaryota] Anabas testudineus GN=BAX (length=579 residues).
atggcatcatacccgggaggaggcgatcaaggaaataccaaagatcagatactggaagtaggatgtgttttgttaaagga
tttcatctatgagcgaattcagaggcatggagatgccagtactgcagtgaccagggcacagctaggtggaggagagctgt
gtgacccaaaccacaagaagcttgcccagtgtctgcagcagattggagatgagctggatgcaaatgtagatctccaaagg
atgataaatgactcttcactcagtcccacaaaagacatatttatgaaagtcgccttagagatcttctcagatggaaaatt
caactggggcagagtggttgctctattctactttgcctgtcgacttgtcatcaaagctgttgtgacccaggttcctgata
tcatcagaaccattatcagttggaccatggattacctccgggaacatgtgataaactggatcagggagcaaggtggctgg
gagggtattcgttcctactttggcacacccacatggcagacggtgggggttttcttggctggtgttctcaccactgttct
cgtcattcgcaagatgtga
© 1998-2019