Dataset for CDS BAX of Organism Anabas testudineus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|R9Y0N7_BAX-01 BCL2-associated X gene OS=[Eukaryota] Anabas testudineus GN=BAX (length=579 residues).
atggcatcatacccgggaggaggcgatcaaggaaataccaaagatcagatactggaagtaggatgtgttttgttaaagga
tttcatctatgagcgaattcagaggcatggagatgccagtactgcagtgaccagggcacagctaggtggaggagagctgt
gtgacccaaaccacaagaagcttgcccagtgtctgcagcagattggagatgagctggatgcaaatgtagatctccaaagg
atgataaatgactcctcactcagtcccacaaaagacatatttatgaaagtcgccttagagatcttctcagatggaaaatt
caactggggcagagtggttgctctgttctactttgcctgtcgacttgtcatcaaagctgttgtgacccaggttcctgata
tcatcagaaccattatcagttggaccatggattacctccgggaacatgtgataaactggatcagggagcaaggtggctgg
gagggtattcgttcctactttggcacacccacatggcagacggtgggggttttcttggctggtgttctcaccactgttct
cgtcattcgcaagatgtga
© 1998-2018