Dataset for CDS Unclassified of Organism Amphiprion percula

[Download (right click)]

4 sequence(s)

>gnl|bcl2dbcds|A0A3P8RQE3_uncBAX-02 Putative BCL2-associated X gene OS=[Eukaryota] Amphiprion percula (length=606 residues).
atggcgtctgaggggaacggaatgtccgacgagagaataggaacagccctgatcaaacaggttatcgaggaagagctgaa
ggatgtcccctcagaggacgtccctcctctcaccccgctggctgtgcagctgaagaccgagcaggaggagaaggtggtga
accagctgggcataatgatccgtattgttggagacaaagtcaaggacgacaaggagttccaagatgcgatagacgggatg
gcctgtggccccggctccaagtgggacagattcaagaaagttacagacaaagtgtttgaacacgggatcacctgggaaaa
cattgctgtgctcttctatgttgccggcaaactggctctcaagatggtggaggctcatctcccccagtcagtgagggatg
tcctgatgtggacggtggacttcttcagaaataatctgctcggctggattcgggaccatggaggatggatcaacagcttc
tcagatctggcggtggcttcagttcagcacgtctcctccttcagctctcagagctatggcctgatcatcatcttcatctc
cggcttggctttaggaagcttcattacctggaggttttccaaataa
>gnl|bcl2dbcds|A0A3P8RQE3_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Amphiprion percula (length=588 residues).
atggcgtctgaggggaacggaatgtccgacgagagaataggaacagccctgatcaaacaggttatcgaggaagagctgaa
ggatgtcccctcagaggacgtccctcctctcaccccgctggctgtgcagctgaagaccgagcaggaggagaaggtggtga
accagctgggcataatgatccgtattgttggagacaaagtcaaggacgacaaggagttccaagatgcgatagacgggatg
gcctgtggccccggctccaagtgggacagattcaagaaagttacagacaaagtgtttgaacacgggatcacctgggaaaa
cattgctgtgctcttctatgttgccggcaaactggctctcaagatggtggaggctcatctcccccagtcagtgagggatg
tcctgatgtggacggtggacttcttcagaaataatctgctcggctggattcgggaccatggaggatgggtacgctggact
ttctttttgtttctgctttctttagggcacttttctctaccatctgcactgaggtacgaactcacactcatcatttattt
gtgttatgtcccgagaattaggggttga
>gnl|bcl2dbcds|A0A3P8TBF2_uncBCLWAV-01 Putative BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Amphiprion percula (length=612 residues).
atgtgtcaactggaagtgccagaggccagactgggcctgaacagtcctgacccgctggtaagagaggcttttctgatggc
ccatgactacatcgactatgtaaccagagggggggctgatggcaccatgggtcctgcccctacagcctgcaccgcagccc
tgcgccacgccggggacgagctcctcacccgcttccccatcttcttcaggcgctggcctcgcgtctttcaggatgtgaca
gaggacacggcctgccccatgctcatgagcatcctggatgagcacttcttcccccccatccccggggggcgacgcaggga
cctggcctggagcgcggtgctgtcggtgtatgtgctggccggccagatggctctgcactgccaagagaggggcatgttgg
cggtcctgccccagctgaaggaatgtgtgggggcatatgtggacagggtcatctgccctgagatacgagacaggggagga
tggactggttttgtatcacgctttggagagaagcaggacttggagggccagctgaagaaagcctgctggtggacactact
ggcacttgccataagcatcatcacctacttcttcataaaaagaatggcttag
>gnl|bcl2dbcds|A0A3P8TBF2_uncBCLWAV-02 Putative BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Amphiprion percula (length=612 residues).
atgtgtcaactggaagtgccagaggccagactgggcctgaacagtcctgacccgctggtaagagaggcttttctgatggc
ccatgactacatcgactatgtaaccagagggggggctgatggcaccatgggtcctgcccctacagcctgcaccgcagccc
tgcgccacgccggggacgagctcctcacccgcttccccatcttcttcaggcgctggcctcgcgtctttcaggatgtgaca
gaggacacggcctgccccatgctcatgagcatcctggatgagcacttcttcccccccatccccggggggcgacgcaggga
cctggcctggagcgcggtgctgtcggtgtatgtgctggccggccagatggctctgcactgccaagagaggggcatgttgg
cggtcctgccccagctgaaggaatgtgtgggggcatatgtggacagggtcatctgccctgagatacgagacaggggagga
tggactggttttgtatcacgctttggagagaagcaggacttggagggccagctgaagaaagcctgctggtggacactact
ggcacttgccataagcatcatcacctacttcttcataaaaagaatggcttag
© 1998-2019