Dataset for CDS BAX-like of Organism Amphiprion percula

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A3P8RKE4_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Amphiprion percula GN=BOK (length=633 residues).
atggagatgttgcgccgctcctctgtgtttgcggctgaagtgtttgaccgatcgcccaccgacaaggagctggtgtccca
ggccaaagctctgtgcagagactacatccactccaggctgaaccgggccgggatcggctggtctaaacccgagcacggac
tggctgcatcaggtgggactctgggagaggtctctggtgtcctgctgtggctgggtgatgagttggaatatcttcgtccc
aacgtgtatcgcaacgtcgcccgacagctgaacatcacagtagcttcagagagcattgtgtctgatgctttcctggctgt
cgctgcagatattttctccacaggtgtgacatggggtaaggtggtttccctgtacgctgtggcaggagctctggcggtgg
actgtgttcgccacggtcatcctgctatggtccacaccattgtggactgcatgggggagtttgtccgcaagagtctgacc
tcctggttaaagaggagaggaggctgggcagatatgaccaaatgtgtggtgaacactgatcccagtttccgttctcactg
gctggtgtctgctgtctgtgcctttggacactacctgaaggccgtcgtgttgtacctcctcagggagaagtga
>gnl|bcl2dbcds|A0A3P8RKE4_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Amphiprion percula GN=BOK (length=627 residues).
atggagatgttgcgccgctcctctgtgtttgcggctgaagtgtttgaccgatcgcccaccgacaaggagctggtgtccca
ggccaaagctctgtgcagagactacatccactccaggctgaaccgggccgggatcggctggtctaaacccgagcacggac
tggctgcatcaggtgggactctgggagaggtctctggtgtcctgctgtggctgggtgatgagttggaatatcttcgtccc
aacgtgtatcgcaacgtcgcccgacagctgaacatcacagtagcttcagagagcattgtgtctgatgctttcctggctgt
cgctgcagatattttctccacaggtgtgacatggggtaaggtggtttccctgtacgctgtggcaggagctctggcggtgg
actgtgttcgccacggtcatcctgctatggtccacaccattgtggactgcatgggggagtttgtccgcaagagtctgacc
tcctggttaaagaggagaggaggctggctctacaagaggaaaacaacgataagttcaccgatgcaaactggactgggata
cgcacaactctccagggagatatgtcaggaaacactgcaaacctcccaagcattacatggcgtctaa
>gnl|bcl2dbcds|A0A3P8RS99_BAX-01 BCL2-associated X gene OS=[Eukaryota] Amphiprion percula GN=BAX (length=618 residues).
atgtctgacagccgagacgaggagaaatcaccgggagagcaggaacctcagggcgccgtgggcggagaagatgttgttga
tgatcccatcttggagcagggagcagtggtcctcagagggtatgtgattgaacgtataaacacagaagaccctagtcggc
acgtctcctctgaggatctgggaggaaggccggatgaactacaggatccacaaattaaagaagtggtggatcagcttctc
aagatagctgatgaactgaacaggaacgctgagctccagcgacttatcaaccaggttcagggaaactgtgctcaggacat
cttcatgaaggttgccaggagcatctttgctgatggaattaactggggtcgagtggtggctctctttcatctggcctaca
gacttatatacaaggctctgactaccaaccatttagagaacatcagaatggttatcagctgggttctccaagtcattaga
gagcagctctatgcctggcttgtgcagcagggaggctgggagggggtgatccgtagcttttctcgatggagggcagcagc
catagtagcatcagtcgtactggtggcaacttttgtttatctcaggaggacacgctga
>gnl|bcl2dbcds|A0A3P8SEB1_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Amphiprion percula GN=BOK (length=642 residues).
atggaggtgctgcgtcggtcctctgtgtttgctgcagaggtgctggatgtgtttgaccgatcgctgactgagaaggagct
ggtgtcccagtccaaagctctgtgcagagactacatcctgtccagactcaaccagaacgggctgggatggtctaaaactg
agatcaactttggtccgtccaatgcagcgctggccgaggtgtctctggtgcttctctgtcttggcgacgagctggagtgt
atacagcccagtctgtacaggaacgtggcgcggcagctcaacatttctgttgccatggagaacatggtttcggatgcctt
cattggcgtggcaacggagatcttctctgcaggtataacatggggtaaggtggtatccatgtacgcagtagctggagccc
tggcagtcgactgtgtcagacaaggccatccaaccacagtacacatcttagtggacagtctgggacagtttgttcgcaaa
ttcctggttccctggctgaaaagacgaggaggatgggctgagattacaaaatgtgtggtgaagaaggatctcacccctga
acaaaactggttctcctctactgtggagtctctcacgtacttcctgaccacaatgtacgtctacatcatgaaggagccgt
ga
>gnl|bcl2dbcds|A0A3P8TFP0_BAX-01 BCL2-associated X gene OS=[Eukaryota] Amphiprion percula GN=BAX (length=579 residues).
atggcatcacacccgggaggaggcgaccaaggaaatggcaaagaacagctcgtggaagtaggagctgctttgttaaagga
cttcatttttgagcgggttcagcggcatggagacggtaaaactgtagtgacaagagcacagctgggtggaggagagctgg
ttgacccaagccataagaagctcggtcagtgcctgcagcagattggagatgagctggatggaaatgtggaactccagagg
atgataaatgattcctcactcagtcctacaaaagacgtgtttctgaaagttgctgttgagatcttttcagatggaaaatt
taactggggcagggtggttgcgctgttctactttgcctgtcgactcgtcattaaggctcttgtaacccaagttcctgata
tcatcagaaccattattcattggaccatggactacctccgggaacatgtgatcaactggatcagggagcaaggtggctgg
gagggtattcgttcccacttcggcactcccacatggcagacagtgggagttttcttggcaggcgttctcaccactgttct
cgtcattcgcaagatgtga
© 1998-2019