Dataset for CDS BOK of Organism Amphiprion ocellaris

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3Q1ANM8_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Amphiprion ocellaris GN=BOK (length=633 residues).
atggagatgttgcgccgctcctctgtgtttgcggctgaagtgtttgaccgatcgcccaccgacaaggagctggtgtccca
ggccaaagctctgtgcagagactacatccactccaggctgaaccggaccgggatcggctggtctaaacccgagcacggac
tggctgcatcaggtgggactctgggagaggtctctggtgtcctgctgtggctgggtgatgagttggaatatcttcgtccc
aacgtgtatcgcaacgtcgcccgacagctgaacatcacagtagcttcagagagcattgtgtctgatgccttcctggctgt
cgctgcagatattttctccacaggtgtgacatgggggaaggtggtttccctgtacgctgtggcaggagctctggcggtgg
actgtgttcgccacggtcatcctgctatggtccacaccattgtggactgcatgggggagtttgtccgcaagagtctgacc
tcctggttaaagaggagaggaggctgggcagatatgaccaaatgtgtggtgaacactgatcccagtttccgttctcactg
gctggtgtctgctgtctttgcctttggacactacctgaaggccgtcgtgttgtacctcctcagggagaagtga
>gnl|bcl2dbcds|A0A3Q1AZQ5_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Amphiprion ocellaris GN=BOK (length=642 residues).
atggaggtgctgcgtcggtcctctgtgtttgctgcagaggtgctggatgtgtttgaccgatcgctgactgagaaggagct
ggtgtcccagtccaaagctctgtgcagagactacatcctgtccagactcaaccagaacgggctgggatggtctaaaactg
agatcaactttggtccgtccaatgcagcgctggccgaggtgtctctggtgcttctctgtctcggcgacgagctggagtgt
atacagcccagtctgtacaggaacgtggcgcggcagctcaacatttctgttgccatggagaacatggtttcggatgcctt
cattggcgtggcaacggagatcttctctgcaggtataacatggggtaaggtggtatccatgtacgcagtagctggagccc
tggcagtcgactgtgtcagacaaggccatccaaccacagtacacatcttagtggacagtctgggacagtttgttcgcaaa
ttcctggttccctggctgaaaagacgaggaggatgggctgagattacaaaatgtgtggtgaagaaggatctcacccctga
acaaaactggttctcctctactgtggagtctctcacgtacttcctgaccacaatgtacgtctacatcatgaaggagccgt
ga
© 1998-2019