Dataset for CDS BAX-like of Organism Amphiprion ocellaris

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A3Q1ANM8_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Amphiprion ocellaris GN=BOK (length=633 residues).
atggagatgttgcgccgctcctctgtgtttgcggctgaagtgtttgaccgatcgcccaccgacaaggagctggtgtccca
ggccaaagctctgtgcagagactacatccactccaggctgaaccggaccgggatcggctggtctaaacccgagcacggac
tggctgcatcaggtgggactctgggagaggtctctggtgtcctgctgtggctgggtgatgagttggaatatcttcgtccc
aacgtgtatcgcaacgtcgcccgacagctgaacatcacagtagcttcagagagcattgtgtctgatgccttcctggctgt
cgctgcagatattttctccacaggtgtgacatgggggaaggtggtttccctgtacgctgtggcaggagctctggcggtgg
actgtgttcgccacggtcatcctgctatggtccacaccattgtggactgcatgggggagtttgtccgcaagagtctgacc
tcctggttaaagaggagaggaggctgggcagatatgaccaaatgtgtggtgaacactgatcccagtttccgttctcactg
gctggtgtctgctgtctttgcctttggacactacctgaaggccgtcgtgttgtacctcctcagggagaagtga
>gnl|bcl2dbcds|A0A3Q1AZQ5_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Amphiprion ocellaris GN=BOK (length=642 residues).
atggaggtgctgcgtcggtcctctgtgtttgctgcagaggtgctggatgtgtttgaccgatcgctgactgagaaggagct
ggtgtcccagtccaaagctctgtgcagagactacatcctgtccagactcaaccagaacgggctgggatggtctaaaactg
agatcaactttggtccgtccaatgcagcgctggccgaggtgtctctggtgcttctctgtctcggcgacgagctggagtgt
atacagcccagtctgtacaggaacgtggcgcggcagctcaacatttctgttgccatggagaacatggtttcggatgcctt
cattggcgtggcaacggagatcttctctgcaggtataacatggggtaaggtggtatccatgtacgcagtagctggagccc
tggcagtcgactgtgtcagacaaggccatccaaccacagtacacatcttagtggacagtctgggacagtttgttcgcaaa
ttcctggttccctggctgaaaagacgaggaggatgggctgagattacaaaatgtgtggtgaagaaggatctcacccctga
acaaaactggttctcctctactgtggagtctctcacgtacttcctgaccacaatgtacgtctacatcatgaaggagccgt
ga
>gnl|bcl2dbcds|A0A3Q1CKY3_BAX-01 BCL2-associated X gene OS=[Eukaryota] Amphiprion ocellaris GN=BAX (length=579 residues).
atggcatcacacccgggaggaggcgaccaaggaaatggcaaagaacagctcgtggaagtaggagctgctttgttaaagga
cttcatttttgagcgggttcagcggcatggagacagtaaaactgtagtgacaagagcacagctgggtggaggagagctgg
ttgacccaagccataagaagctcggtcagtgcctgcagcagattggagatgagctggatggaaatgtggaactccagagg
atgataaatgattcctcactcagtcctacaaaaggcgtgtttctgaaagttgctgttgagatcttttcagatggaaaatt
taactggggcagggtagttgcgctgttctactttgcctgtcgactcgtcattaaggctcttgtaacccaagttcctgata
tcatcagaaccattattcattggaccatggactacctccgggaacatgtgatcaactggatcagggagcaaggtggctgg
gagggtattcgttcccacttcggcactcccacatggcagacagtgggagttttcttggcaggcgttctcaccactgttct
tgtcattcgcaagatgtga
>gnl|bcl2dbcds|A0A3Q1CTC5_BAX-01 BCL2-associated X gene OS=[Eukaryota] Amphiprion ocellaris GN=BAX (length=618 residues).
atgtctgacagccgagacgaggagaaatcaccgggagagcaggaacctcagggcgccgtgggcggagaagatgttattga
tgatcccatcttggagcagggagcagtggtcctcagagggtatgtgattgaacgtataaacacagaagaccctagtcggc
acgtctcctctgaggatctgggaggaaggccggatgaactacaggatccacaaattaaagaagtggtggatcagcttctc
aagatagctgatgaactgaacaggaacgctgagctccagcgacttatcaaccaggttcagggaaactgtgctcaggacat
cttcatgaaggtcgccaggagcatctttgctgatggaattaactggggtcgagtggtggctctctttcatctggcctaca
gacttatatacaaggctctgactaccaaccatttagagaacatcagaatggttatcagctgggttctccaagtcattaga
gagcagctctatgcctggcttgtgcagcagggaggctgggagggggtgatccgtagcttttctcgatggaggacagcagc
catagtagcatcagtcgtactggtggcaacttttgtttatctcaggaggacacgctga
© 1998-2019