Dataset for CDS Unclassified of Organism Amphimedon queenslandica

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A1X7VMB9_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Amphimedon queenslandica (length=756 residues).
atggcgacggggggtagagaaggaggccaagctgagctgtcgagaaggaggcaagcttttcggacaggagccactgatag
tctagacgagctctccgaggaggagagaagagaaactgagagagctttgtacgagtacgtcttcaggagagcagagaaag
acgagaaactatcccgagatgaagtggagtcctttcgggaggcagagatcaacaaagcaaggacagaaagcgaagctacc
agtgaatcagatggaggaggaggaggagagagcaatgctaaggctgtcgggcgacgtctagctgagcttggagatgagat
agactcaatgtacagcggccattttgaggacatcatgcaaatgtatagtgacaatcctgaccaagcattcgttactttct
cgactgtactacagaatgtttttgaatgggatgaatttggactacctaagctcaatgttggacgcattgctgctgtacta
ggctactgttatcacttgtgtaaaaactacatctctaaatactttagttcttctggactcttgagtgtccttgcagtaat
tgctagctttctagtcaagttcttcctcaaagcaaagttctatgacatgctaaaacgagttggaggatggggtcagctta
ttcagctacctgctgctagtgtgctaaatcgaattgcttcaactccaaatttctttttggttgttggagtcgcttccttg
gctatttacgcatttcaatatttccgtggaagataa
>gnl|bcl2dbcds|A0A1X7VNS3_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Amphimedon queenslandica (length=744 residues).
atggcgagcaagatgcttagtccacaaatctctccttccgactttgaagatgaagaagaactccactctgtacctgaaga
cattaggaaccagacccaagtgatgttctacgagtacgtggacagtaggtgtagccacgacagagacttatccaaggaac
aggcttccctccttcacgagtcagcatctacttgtataagaaaaactgacgtgggtggacagggcgaagcagctgaaagg
attgctatcctattatgtgaatacggcgacaagttccaaaaggaatttgacaatgatcaaaacttacagaaactaatgac
agaaggtactagtgacactgatactggggagccttcaacatccagtgtccttgcacacgttaggattgtcgtggaaagga
tttttggtgtcaactctaacggagaaataatggtccagaatatcacatttggtaggattgcatctttattttattacatt
tattcactctgcaagaggttcttaaagaatacatttgctaaccacactctcatgcaaacaatgtgtgccctcggtgggta
ccttgttgtatccctggttagagtaaagttcttccagtggctgaaagatcaaggaggatggggccaggctattgttaaca
tttctacgagcattacgctacccacgtggggtaataatgtaatattggcaggtggggtctttcttattggtctgtgggca
tacaggatgtacaaaggactctga
© 1998-2018