Dataset for CDS Unclassified of Organism Amphilophus citrinellus

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A3Q0RW67_uncBCLWAV-01 Putative BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Amphilophus citrinellus (length=495 residues).
tgccatggaggatacatcctcaatactttatttcctaaaataaaaaatcaaaccatgggttcagcccccacagcttgcac
cgcagccattcgccatgctggcgacgagctccttgcttgcttccccatttttgagcactggccacgcatcttccaggata
tgacagagaactcagcccatggcaccgtattgtctgaatatgtgctagctggccaggtggctatatactgtcaagagcct
ggagtgctccagctggaggagtgtgttggggcctatgtggaaaggcatttggcacgcaccttttgtctggtttttggaga
gaagcaggacctggagtggcacttaaagtgtgtagattccttggccacaagcatccacacctattttttctggaagagaa
tttcttggccaacactgccacccactgacctcaagcagaaactacaagagagcaacaccacaaaatgtctacagtgcatt
tgttcattcctgtag
>gnl|bcl2dbcds|A0A3Q0SNX2_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Amphilophus citrinellus (length=546 residues).
tttaccgcactcatagaggaagagctgaaggatgtgccctcggaggacatcccgcctctcactccactgactgaggtgaa
gaccgaacaggagaagaagatggtcatgcagctgagcaaaatgatccgtatcatcggtgacagagtgcaggatgacaagg
atgtgatagatggtgtggcttctgcccctggctccaaatcagacaattttcggcaagtggcaaacaaagtgtttgcagat
ggaatcacctgggagaagatcgctgtgctcatctatgtggctggcaggcttgctgttaagatggtggaggctcatctccc
tcagtcagtcagagaggtcctttcctggacggtgagcttcttcagaaacaacctactgagctgggttcaggaacatggag
gatggatcaacagtttctcagagctggcggttgtgtccatgcagagtgtgtcagtgagctctcacagctatggcctcatc
atcatcttcatcgctggcatggctataggaagtttgatcacctggaggctaagcagacagtcctga
© 1998-2019