Dataset for CDS BOK of Organism Amphilophus citrinellus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3Q0RFY4_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Amphilophus citrinellus GN=BOK (length=633 residues).
atggagatgttgcgccgctcctctgtgtttgcctctgaagtgtttgatcgctcgcccaccgacaaggagctggtgtccca
ggccaaagcgctgtgcagggactacatccactccaggctgaaccgggccgggatcggctggtccaagcctgagcacggac
tgtctgcgtcaggtgggactctgggagaaatatcgtcggtcctgctgtggctgggtgatgagttggagtgccttcgtccc
aatgtgtaccgtaacgtcgcccgacagctgaacatcacagtggcgtcggagggcgtggtgtccgatgccttcctggctgt
cgctgcagacattttctccacaggtgtcacatggggaaaggtggtttccttgtacgctgtggcgggagccttggcggtgg
actgtgtacgccacggtcatccagcaatggtccataccattgttgactgcatgggggagtttgtccgcaagagtctgacc
gcctggttaaaaaggagaggaggctgggtggatgtaacgaagtgcgtggtgaacactgaccccagcttccactctcactg
gctggtgtctgctgtctgtgccttcgggcactacctgaaggcggtcgtgctacacctcctccgggagaagtga
>gnl|bcl2dbcds|A0A3Q0S613_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Amphilophus citrinellus GN=BOK (length=642 residues).
atggaagtcctgcgcaagtcatcagtatttgcttcggaggtcttggacgtgtttgaccgatcgctgactgaaaaggagct
ggtgtcccagtccaaggcactgtgcagagactacatcttgtccagactcacccagaacgggttgggatggtccaaaactg
agctcaatttttctccctcgaatgcagcgctggctgaagtgtctatggtgcttctctgtcttggcgatgagctggagtgt
atacagcctactttgtacaggaacgtggcgcggcagctcaacatttcagttgccatggagaacatggtttcggatgcctt
catcggcgtagcaacagagattttctcagcaggcataacatggggtaaggtggtgtccatgtatgcagtagctggagccc
tggcagtggactgtgtcagacaaggccatccagccacagtacacatcttagtggacagtctgggacagtttgtccgcaaa
ttcctggttccctggctgaagagacggggagggtgggtaagtatcacaaaatgtgtggtgaagaaggatcttgctcctga
agaaaactggctgtcatccacctttgagtctctcaaatacttcctgaccacgctatatgtctacatcatgaaggagccgt
aa
© 1998-2019