Dataset for CDS BAX of Organism Amphilophus citrinellus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3Q0R008_BAX-01 BCL2-associated X gene OS=[Eukaryota] Amphilophus citrinellus GN=BAX (length=615 residues).
atgtacagcatcatagcatctgttctgtgcagcaggaaccattgcatcagagcgctggaaaacctcaggtctgaggatgc
tgatatgctcacttttcttcattgcatccaccacatgtatgtgatcacacgcataaacacagaggaccctagtcggcatg
tcacctctgaggatctgggaggaaggccagatgaacaacaggatccacaaatcaaagaagtggtggaccagttgcgcaag
atagcggatgagttaaatcggaatgctgagcttcagggactgatcaaccaggttcaggggaactgtgctcaggacatctt
catggcggtggcaagaaacatctttgctgatggcatcaactggggtcgaattgtggctctcttccatctggcctatagat
taatatacaaggctcttaccaccaatcatttagagaacattcgaatggtcatcagctgggttcttcaagtcatcagagag
cagctccacacctggctcgtgcagcaagggggctgggagggggtgattggtagtttttctcgatggaggacagtggccat
tgtagcatcagtagcattggtggtagcctttgtttactaccggaaagtacgatga
>gnl|bcl2dbcds|A0A3Q0S1T8_BAX-01 BCL2-associated X gene OS=[Eukaryota] Amphilophus citrinellus GN=BAX (length=525 residues).
gaagtgggaactattttgctaaaggacttcatctatgagcgtgttcggagacatggagacagcaatactgtagtgacgag
ggagcagctgggtggaacccagctgactgaccaaaaccataagaggcttgcacagtgcctgcagcagattggagatgagc
tggatggaaatgtagagctccaaaggatgatagatgactcttcacttagtcccacaaaagacatttttctgaaagtggcc
attgagatcttctcagatggaaaatttaactggggcagggtggttgcactgttctactttgcatgccgactcgtcatcaa
agctcttgtaacccaaattcctgatattatcagaaccattatcgtttggaccatggactaccttcgggaacatgtgatca
actggatcagggagcaaggtggctgggagggtattcgctcctactttggcacacccacatggcagacggttggggttttc
ttggcgggagtcctcaccactgttcttgtcattcgcaagatgtga
© 1998-2019