Dataset for CDS BOK of Organism Ailuropoda melanoleuca

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G1MDG6_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BOK (length=576 residues).
atggaggtgctgcggcgctcctcggtcttcgcggcggagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgccggcgcctgtccccggaggccgcctggcggaggtgtgcgccgtgctgctgcgcctggggg
acgagctggagctgatccggcccagcgtctaccgcaacgtggctcgccagctgaacatctccctgcagtctgaaaccgtg
gtgaccgacgccttcctggctgtggcgtctcagatcttctctggaggcatcacatggggcaaggtggtgtccctgtactc
ggtggccgcggggctggccgtagactgtgtgcggcaggcccagcctgccatggtccacgctctcgtcgactgccttgggg
agtttgtgcgcaagaccctggcaccctggctgcgaagacgcggtggatggaccgacgtcctcaagtgtgtggtcagcacg
gagcccggcttccgctcccactggctcgtggccgcactctgcagctttggccgcttcctgaaggctgctttcttcgtgct
gttgccggagagatga
© 1998-2018