Dataset for CDS BAX-like of Organism Ailuropoda melanoleuca

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|G1L3H7_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BAK1 (length=648 residues).
atggcatccgggcaaggcccaggtcctcccaggcaggagtgtggagagacggccccatcttctacttctgcctcagagga
gcaggtagcccgggacaccgaggaggttttccgcagctatgttttttaccgccatcggcaggagcaggaggctgaggggg
cggctgcgcctgctgacccagaaatggtctccttgtccctagaacctagcagcaccatggggcaggtgggtcggcagctc
gccatcatcggggatgacatcaaccagcgctacgactctgagttccagaccatgctgcagcacctacagccaacagcaga
gaacgcctatgagtatttcaccaagatcgcctcgagctgcagcctgtttgagagcggcatcaactggggccgagtggtgg
ctctcctgggcttcggctaccgcctggccctacacgtctaccagcgtggactgaccggcttcctgggccaggtgacccgc
ttcgtagccgacttcatgctgcatcattgcattgcccggtggattgcgcagaggggcggctggcaggtggcagccctgaa
cttgggaaatggccccatcctcaacgtgctgatagttctgtctttggttctcttgggccagtttgtggtacgaagattct
tcaaatca
>gnl|bcl2dbcds|G1M7S3_BAX-01 BCL2-associated X gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BAX (length=579 residues).
acccggcgagaggcggaacaacccagaggcagggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaagatcgagcagggcgaatggggggagagacacctgagctggccctggagcaggtgccccaggacg
catccaccaagaagctgagcgagtgtctcaaacgcatcggagatgaactggacagtaacatggagttacagaggatgatc
gcagccgtggacacagactccccgcgcgaggtctttttccgagtggcagctgacatgttttccgatggcaacttcaactg
gggccgggttgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgagctgatca
ggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
ctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggctggagtgctcactgcgtcactcaccat
ctggaaaaagatgggctga
>gnl|bcl2dbcds|G1MDG6_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BOK (length=576 residues).
atggaggtgctgcggcgctcctcggtcttcgcggcggagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgccggcgcctgtccccggaggccgcctggcggaggtgtgcgccgtgctgctgcgcctggggg
acgagctggagctgatccggcccagcgtctaccgcaacgtggctcgccagctgaacatctccctgcagtctgaaaccgtg
gtgaccgacgccttcctggctgtggcgtctcagatcttctctggaggcatcacatggggcaaggtggtgtccctgtactc
ggtggccgcggggctggccgtagactgtgtgcggcaggcccagcctgccatggtccacgctctcgtcgactgccttgggg
agtttgtgcgcaagaccctggcaccctggctgcgaagacgcggtggatggaccgacgtcctcaagtgtgtggtcagcacg
gagcccggcttccgctcccactggctcgtggccgcactctgcagctttggccgcttcctgaaggctgctttcttcgtgct
gttgccggagagatga
© 1998-2018