Dataset for CDS BAK1 of Organism Ailuropoda melanoleuca

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G1L3H7_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BAK1 (length=648 residues).
atggcatccgggcaaggcccaggtcctcccaggcaggagtgtggagagacggccccatcttctacttctgcctcagagga
gcaggtagcccgggacaccgaggaggttttccgcagctatgttttttaccgccatcggcaggagcaggaggctgaggggg
cggctgcgcctgctgacccagaaatggtctccttgtccctagaacctagcagcaccatggggcaggtgggtcggcagctc
gccatcatcggggatgacatcaaccagcgctacgactctgagttccagaccatgctgcagcacctacagccaacagcaga
gaacgcctatgagtatttcaccaagatcgcctcgagctgcagcctgtttgagagcggcatcaactggggccgagtggtgg
ctctcctgggcttcggctaccgcctggccctacacgtctaccagcgtggactgaccggcttcctgggccaggtgacccgc
ttcgtagccgacttcatgctgcatcattgcattgcccggtggattgcgcagaggggcggctggcaggtggcagccctgaa
cttgggaaatggccccatcctcaacgtgctgatagttctgtctttggttctcttgggccagtttgtggtacgaagattct
tcaaatca
© 1998-2018