Dataset for CDS Unclassified of Organism Acanthochromis polyacanthus

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A3Q1EA77_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Acanthochromis polyacanthus (length=612 residues).
atggcgtctgaggggaacggtatgtccgacgagagaataggaacagccctgatcaaacacgttatagaggaggagctgaa
ggatgtcccctcagaggaattccctcctctcaccccgctggctgtgcagctgaacaacgagcaggaggagaaggtggtga
accagctgagcaaaatgatccggattattggagactcagtgaagggcaacgaggagttccaagatgcgatagatgggatg
gcccgtgaccccggctccaagtgggacaaattcaagaaggttacagacaaagtgtttgaatacgggatcagctgggaaaa
catcgctgtgctcttctatgttgccggaaagctggctctgaagatggtggaggctcatctcccccagtcagtgagggacg
tcctgatgtggacggtggacttcttcagaaataatctgctgggctggattcgggaccatggaggatggatcaacagcttc
tcagatctggcggtggcttcagtgcaccaggtctcctccttcagctccaggagctacggccggttcaccatcttcatctc
tggcttggttttaggaagcttcattacctggaggcttaccaaatcactctga
>gnl|bcl2dbcds|A0A3Q1FXE4_uncBCLWAV-01 Putative BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Acanthochromis polyacanthus (length=612 residues).
atgtgtcagctggaagtgccagaggccagactgggcctgaacagtcctgacccgctggtaagagaggctttcctgatggc
ccatgactacatagactatgtaaccagaggaggggctgatggcaccatgggtcctgcccctacagcctgtaccgcagccc
tgcgccacgccggagacgagctcctcacacgtttccccatcttcttcaggcgctggcctcgcgtcttccaggatgtgaca
gagaacacggcctgccccatgctcatgagcatcctggatgagcacttcttcccccctgtccccggcgggcgacgcaggga
cctggcctggagcgcggtgctgtcggtgtatgtcctggccggccagatggctctgcactgccaagagaggggcatgttgg
cggtcctgcctcagctgaaggaatgtgtgggggcatatgtggacagggtcatctgccctgagatacgagacagaggagga
tggactggctttgtatcacgctttggagagaagcaggacttggagggccagctgaagaaagcctgttggtggacactact
ggcactggccataagcatcatcacctacttcttgataaaaagaatgacttag
© 1998-2019