Dataset for CDS BOK of Organism Acanthochromis polyacanthus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3Q1F1K1_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BOK (length=633 residues).
atggagatgttgcgccgctcctctgtgtttgcggctgaagtgtttgaccgatcacccaccgacaaggagctggtgtccca
ggccaaagctctgtgcagagactacatccactccaggctgaaccgggcagggatcggctggtctaaacccgagcacggac
tggctgcgtcaggtgggactctgggagaggtctcctctgtcctgctgtggctgggtgatgagttggaatatcttcgtccc
aacgtttatcggaacgtcgcccgacagctgaacatcacagtagcttcagagagcattgtgtctgatgccttcctggctgt
tgctgcagacattttctccacaggtgtgacatgggggaaggtggtttccttgtatgctgtggcaggagctctggcggtgg
actgcgttcgccacggtcatcctgctatggtccacaccattgtggactgcatgggggagtttgtccgcaagagtctgacc
tcctggttaaagaagagaggaggctgggcagatatgaccaaatgtgtggtgaacactgatcccagtttccgttctcactg
gctggtgtctgctgtctgtgcctttggacactacctgaaggccgtcgtgttgtacctcctcagggagaagtga
>gnl|bcl2dbcds|A0A3Q1FIY9_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BOK (length=642 residues).
atggaggtgctgcgtaggtcctctgtgtttgctgcagaggtcctggatgtgtttgaccgatcgctgactgagaaggagct
ggtgtcccagtccaaagctctgtgcagagactacatcctgtccagactcaaccagaacgggctgggatggtctaaaactg
agatcaactttggtccgtccaatgcagcgctggccgaggtgtctctggtgcttctctgtcttggcgacgagctggagtgt
atacagcccagtctgtacaggaacgtggcgcggcagctcaacatttctgttgccatggagaacatggtttcggatgcctt
catcggtgtggcaacggagatcttctctgcaggtataacatggggtaaagtggtatccatgtacgcagtagctggagccc
tggcagtcgactgtgtcagacaaggccatccaaccacagtacacatcttagtggacagtctgggacagtttgttcgcaaa
ttcctggtgccctggctgaaaagacgagggggatgggtgagtattacaaaatgtgtggtgaagaaggatctcgctcccga
acaaaactggttctcctctactgtggagtctctcaagtacttcctgaccacaatgtacgtctacatcatgaaggagccgt
ga
© 1998-2019