Dataset for CDS BAX-like of Organism Acanthochromis polyacanthus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A3Q1F1K1_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BOK (length=633 residues).
atggagatgttgcgccgctcctctgtgtttgcggctgaagtgtttgaccgatcacccaccgacaaggagctggtgtccca
ggccaaagctctgtgcagagactacatccactccaggctgaaccgggcagggatcggctggtctaaacccgagcacggac
tggctgcgtcaggtgggactctgggagaggtctcctctgtcctgctgtggctgggtgatgagttggaatatcttcgtccc
aacgtttatcggaacgtcgcccgacagctgaacatcacagtagcttcagagagcattgtgtctgatgccttcctggctgt
tgctgcagacattttctccacaggtgtgacatgggggaaggtggtttccttgtatgctgtggcaggagctctggcggtgg
actgcgttcgccacggtcatcctgctatggtccacaccattgtggactgcatgggggagtttgtccgcaagagtctgacc
tcctggttaaagaagagaggaggctgggcagatatgaccaaatgtgtggtgaacactgatcccagtttccgttctcactg
gctggtgtctgctgtctgtgcctttggacactacctgaaggccgtcgtgttgtacctcctcagggagaagtga
>gnl|bcl2dbcds|A0A3Q1FIY9_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BOK (length=642 residues).
atggaggtgctgcgtaggtcctctgtgtttgctgcagaggtcctggatgtgtttgaccgatcgctgactgagaaggagct
ggtgtcccagtccaaagctctgtgcagagactacatcctgtccagactcaaccagaacgggctgggatggtctaaaactg
agatcaactttggtccgtccaatgcagcgctggccgaggtgtctctggtgcttctctgtcttggcgacgagctggagtgt
atacagcccagtctgtacaggaacgtggcgcggcagctcaacatttctgttgccatggagaacatggtttcggatgcctt
catcggtgtggcaacggagatcttctctgcaggtataacatggggtaaagtggtatccatgtacgcagtagctggagccc
tggcagtcgactgtgtcagacaaggccatccaaccacagtacacatcttagtggacagtctgggacagtttgttcgcaaa
ttcctggtgccctggctgaaaagacgagggggatgggtgagtattacaaaatgtgtggtgaagaaggatctcgctcccga
acaaaactggttctcctctactgtggagtctctcaagtacttcctgaccacaatgtacgtctacatcatgaaggagccgt
ga
>gnl|bcl2dbcds|A0A3Q1FSZ4_BAX-02 BCL2-associated X gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BAX (length=618 residues).
atgtctggcagccgagacgaggataaacccccgggagagcaggaacctcaaggcgccgtcggcggagaagatgttgttga
tgatcccatcttggagcagggagcagtggtcctcagagggtatgtgattgaacgtataaacacagaagaccctagtcggc
acgtctcctctgaggatctgggaggaaggccagatgaactacaggatccacaaattaaagaagtggtggatcagctactc
aagatagctgatgacctgaacaggaacgctgagctccagcgacttatcaaccaggttcagggaaactgtgctcaggacat
cttcatgaaggtggccaggagcatctttgctgatggaataaactggggtcgagtggtggctctctttcatctggcctaca
gacttatatacaaggctctgaccaccaaccatttagagaacatcagaatgattatcagctgggttctccaattcattaga
gagcagctctatgtctggcttgtgcagcagggaggctgggagggggtgatccgtagcttttctcgatggaggacagcagc
catagtagcatcagtagtactggtggcaacttttatttatctcaggaggacacgctga
>gnl|bcl2dbcds|A0A3Q1FSZ4_BAX-01 BCL2-associated X gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BAX (length=615 residues).
atgtctggcagccgagacgaggataaacccccgggagagcaggaacctcaaggcgccgtcggcggagaagatgttgttga
tgatcccatcttggagcagggagcagtggtcctcagagggtatgtgattgaacgtataaacacagaagaccctagtcggc
acgtctcctctgaggatctgggaggaaggccagatgaactacaggatccacaaattaaagaagtggtggatcagctactc
aagatagctgatgacctgaacaggaacgctgagctccagcgacttatcaaccaggttcagggaaactgtgctcaggacat
cttcatgaaggtggccaggagcatctttgctgatggaataaactggggtcgagtggtggctctctttcatctggcctaca
gacttatatacaaggctctgaccaccaaccatttagagaacatcagaatgattatcagctgggttctccaattcattaga
gagcagctctatgtctggcttgtgcagcagggaggctgggtgagtggtacatcatctgtaaagttttgtcctgtatgttt
gtttaaggctttctggtctcctgcatggacttgttcggggatccaaagttcctaa
>gnl|bcl2dbcds|A0A3Q1FXV2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BAX (length=579 residues).
atggcatcgcacccgggaggaggtgaccaaggaaatggcaaggaacagctagtggaagtaggagctgctttgttaaagga
cttcatttttgagcgggttcagcggcatggagatggtaatactgtagtgacaagagcacagctgggtggaggagagctgg
ttgacccaaatcataagaagctcggtcagtgcctgcagcagattggagatgagctggatggaaatgtggagctccagagg
atgataaatgattcctcactcagtcctacaaaagatgtgtttatgaaagttgctgttgagatcttttcagatggaaaatt
taactggggcagggtggttgctctgttctactttgcctgtcgactcgtcattaaggctcttgtaacccaagtacctgata
tcatcagaaccattattcattggaccatggactacctccgggaacatgtgatcaactggatcagggagcaaggtggctgg
gagggtattcgttcccactttggtactcccacatggcagacagtgggagttttcttggcaggcgttctcaccactgttct
cgtcattcgcaagatgtga
© 1998-2019