Dataset for CDS Unclassified of organism all

[Download (right click)]

22 sequence(s)

>gnl|bcl2dbcds|A0A3Q1G016_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Acanthochromis polyacanthus (length=522 residues).
atggatgatgaggaggaggacatgtcacggcccatctcgcagctctggggaacgtcctttggggacgtcaaattcgaaga
ccgcgccacacagatcacagccggacaggccttcgccagccacgacaacaacagcatcaacgcgctgccctgcggcttac
accggcagcctcacataccctttcacggcaacgctggattgcgctcacattttcccgctcagtttgagcccatggaggac
cggggagagagggaggttgaagaggaggaggaagagggcagaggggaagacaatgaaagaatggcggagcggcccgagga
gcaggcgggggtgagcgtggaggcgcagatcggtcgtaaacttcgggagatcggagacaagtttcaccaggatcatgttg
aactgtttatgaggcatcagagacaaaacctgcctgtctggatgcgccttacgatggccctgtttggctttttgtttcca
agagaggcccacgtcccccgtctgagaggagcgcagagatga
>gnl|bcl2dbcds|A0A3Q0RUR2_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Amphilophus citrinellus (length=537 residues).
ttggcgagaccaccaaaaccgtccgatggcccgaccgcagtaacggcatcagaggacagcgggggagatccaccacccgt
gtgtgccactggagcgcaaacatcccgtttaaaccgcgagtctactggaggaggagaaccggattcgccttcctgggcca
gaaccccgacgagctttgcggcttatcagagcagaacaatatttcgcttccctcgccgttcctccagtggatatttttcc
atggagtgcgactcgatgccgagctccccgctctccccgaagccaatgatggctgacaaagcgatacagaccccaagcct
ctcaagccaggtgctaacgcacgccctgcagcgcatgggtgaagtacgcgacgaaggaccggagacgaaccaacaacagg
gtgagcacagacaaatgtgtgtatttgtgtactatgacacacaatgtaggaacctgtcagtgaacctaaagaaagaaagt
tctgcctcgcctaatggttttcaagtttatattcttggcagtatttttattagttaa
>gnl|bcl2dbcds|A0A3Q0SC56_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Amphilophus citrinellus (length=423 residues).
atggacgatgaggaggatgatgtgtttaagccnaaagcccgctgctggcacaccacattcaggcagataaagtgtgaaca
ccgaggcacacagacacccggtcctgccctggtaccaaacaacggcatgctgccctgttttcgattgcacttcccagcac
gctttgagcttgttggggatcacgaagcgcggcaacaagaaagcgaagagcagccaaacaggatggagcgtctgccccgg
cagcgacccgtggcacgcggcgtggaggcttgcattggacagaagctccagctcataggagaccagtttcaccgggaacg
cctacaactggggccgctgtggtggcgcctggccgcggctctcctcagccttctgtttgatagggggttctttgctggag
gaggtggcgcaggacggaggtga
>gnl|bcl2dbcds|A0A3P8RSQ3_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Amphiprion percula (length=516 residues).
atggatgatgaggaggaggacatgtcacggcccatctcgcagccccggggaacgtcctttggggacgtcaaattcgaaga
ccgcgccacacagatcgcagctggacaggccctcgctgccgtcactgccgctgtgtccacgtcgcagagccacaacaaca
acagcatcaacgcgctgccctgcggcttacatcggcagcctcacataccctttcacggcaacgctgggttgcgctcacat
tttcctgctcagtttgagcccatggaggaccggggagagagggaggttgaagaggaggaggaagagggcagaggggaaga
caatgacagaatggcggagaggcccgaggagcaggcgggggtgagcgtggaggcgcagattggtcgtaaacttcgggaga
ttggagacaagtttcaccaggatcacgttgaactggtaagcctcactgctgagctgtggaccagatccacgattaactgt
ccacttcaaacaccacactctagagctcaatcttaa
>gnl|bcl2dbcds|A0A3Q1HMF6_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Anabas testudineus (length=429 residues).
atggatgatgaggaggaggacatgtcacggcccatctcgcagcactggggaacgccctttagggacgtcaaatacgaaga
cctacccacacagatctcagccggacaggcccttgctggcatcaccgcgcggcagcctcacataccctttcacggtaaga
aggggttacacgttgagccggccagacacagggaggatgatgacaggatggcacagaggcccgaggatcaggcaggggtg
agcgtcgaggtgcaaattggccgtaaacttcgagagatcggagacaagtttcaacaggatcaccttgaactgtttgtaag
gcaccagagacaaaatctgccaatctggatgcgccttactatggccctgtttggctttctatttccaagagaggctctca
tcccccgcctgagaggagagcagagataa
>gnl|bcl2dbcds|B6IM60_uncEGL1-01 Putative Egg-laying defective 1 gene OS=[Eukaryota] Caenorhabditis briggsae (length=405 residues).
atggattctcgcttccaattctcttcttcatcatcatgtttcaatcgtcccacaaaactgtccaaaaacgtcaaatttga
gttttcgagtcaggaaatcgcattggatcgtttcaacaccacccgaatggaacctttcttctccattggccacactattg
gaaagcaacttagtaaattatgcgacgactttgacaaggagatgatggcgcatgctcacaaaacgtcgatcgttgcaact
gtgaaatcgctatggaacgtcatgttcaccaacttctctccccaagaagctttttgttttgacgtaaaaaacaagaacag
ccgcactcgtcgccattgctccgttattgccaagcgttgccgagttctcttctccaaagttttcaatttcatcatcaagt
gttaa
>gnl|bcl2dbcds|Q9TY06_uncEGL1-01 Putative Egg-laying defective 1 gene OS=[Eukaryota] Caenorhabditis elegans (length=297 residues).
atgatgtcgtacaagcgtgatggatatttttcaattgtgtcaagctgcctaattttttgtctacactttctcccgctgtt
gtctattaggaccaaattaagctccctgtttatcacttctctcgcaaataatgcttgcaactcaaacaccgttgaatata
atattggcagaaaactgacagttatgtgcgacgagtttgactctgaactgatgtcctacaaagaagaaaaatcatttgtg
aaatttctaggctcaggattcaagacgtatgccagcattgttcgtcgtgttttttaa
>gnl|bcl2dbcds|A0A3G3M2I9_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Carassius auratus (length=267 residues).
atgtctgacacgtccgaggtatggtttgccgaacctagccaccagcacgtgcagatggcagcacctgtgggagccatggg
gccggagatttcggtcgctcgggagctgcggcgcattggagacgagttcaaccgcttgtactgtcaaggggccggtgcag
gtgggaacaacagagcccagctgcatgctcccaatgaacacgccatcatcatgtggatgaacgaccttatcggacgtgta
gtacagtttttcctgcgaagaagatga
>gnl|bcl2dbcds|A0A3P8UBL4_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Cynoglossus semilaevis (length=351 residues).
atgagaagaaaaggcgagttcatttcagctcgtgcaccgacgggccgttcagtcgagtgtcagagagaaggagggagggc
ggaggagaggaaatctcctcagagcacagacaaaagagttaggagtttgtttaccgactccgtgccgagctccccgaggc
cagtgacggctgacaaagccacgcagactccgagtccctccgcccaggtgatcaatcacgccctgctgagcgtggccgag
acgcagcggacgaacggtgaacgactacgacagattcatccggaacgtgagtggcctctgacgtgtgtgtgtgtgtgtgg
gtttgtgtttttgtacctgtgtgggcgataa
>gnl|bcl2dbcds|A0A3P8W5W5_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Cynoglossus semilaevis (length=264 residues).
atgaaacaggaattcagaataaagccagagtatacagaaaacatgatgaataaattattatttacaccctcactgttaag
ctgccctggcagtcgtatttgcttgtttcctctgaggcattgttgtgggggatgcaacactgaaagccagttggaaatgg
tttgtcctccatttcaactttcagcattttccactgcctgtccagtcgtgcttcctttgactcctctgactcaatcaaga
cgtgaggattctcgttggtattga
>gnl|bcl2dbcds|A0A3Q2FS95_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Cyprinodon variegatus (length=729 residues).
atgaatgacatgcaatcttcaagaccgccaaacctgcgcgatggctcgaccgaagtaacttcagaggaggggaccgaggg
agacccagcagcctcagcgcgaaaaccacgtctgtcgaagcgcagagagcggagctgcgcgctgcagccgggcgccgctg
gcaccgcaggaggaggaagggatccggactcggactcgccgccctgttccgtaagcccggccagtttagacgtctttcga
agcaggtcgattttccgccctactcgccgctcatccagcggatacttctcctttgactgtgactcgcttccgagctcccc
gctcaccccgcacccggtgacggctgacaaagccacacagactgccagtcccacgggccaggtgatgaagcacgccctgc
agcgaatggctgtggagcagggtggacagggagcgcccgggctgcacggacattctgccataccctatagcgagtgggag
ggaatcgcagcacgggatatgcagtcagaaacctttggtcgtcagctccggaccatcggagatgaatataacaaccacct
gctgagaatggcaggaagacaccgacggaatattgtccctctaaacctgatgccacacatccaacaagagccagttgcca
tgctctgtgtcggactcctgcttctcttgattggacgaataatgtacttgcaaggcagtacaagcagccatgaccaccct
caggtttag
>gnl|bcl2dbcds|A0A2R8RYV1_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Danio rerio (length=681 residues).
atggatgatgaggaggatgaacagcttcctcgctgctgtgaaacgccgctaagaaacaagcgctccgagaagagagacgc
ccacggtggagacgtgggacaaacagctcacagacacgcatccacacagactgctggctctgtcctcaattcagcgagag
acgcagatatggcaccattccagggctcacagagagaagcatcatctctttgcagagttgtgggtgctaggactgcattc
agggctccctgtggaactgggggccttgtgtcacttactatgggccccggagcccggggtgggccaagagcactttttca
tggaaacgctggatttcgtgcacacttccctgcgctgttcgaacccgccctggatggcttacaaaacgccgaacagagag
agcaggacgaaggcagaccagaagaaaaagaagaggatcgcgacgcagggattagcgtggaggtccagattggacgtaaa
ttacgtgaaatgggggatcagtttcagcaagagcatcttcagctggtaagagtcattcacatcagactgattcttttctt
caaggccgctgggtttcagatgtgtgtggtcagaaactggtggtttcagtcacgatgcaaaatgacatcactgtctgcta
tttcagtgctgaatatgcaaattcccaagagggagcaatga
>gnl|bcl2dbcds|Q0GKC4_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Danio rerio (length=627 residues).
atggatgatgaggaggatgaacagcttcctcgctgctgtgaaacgccgctaagaaacaagcgctcagagaagagagacgc
ccacggtggagacgtgggacaaacagctcacagacacgcatccacacagactgctggctctgtcctcaattcagcgagag
acgcagatatggcaccattccagggctcacagagagaagcatcatctctttgcagagttgtgggtgctaggactgcattc
agggctccctgtggaactgggggccttgtgtcacttactatgggccccggagcccggggtgggccaagagcactttttca
tggaaacgctggatttcgtgcacacttccctgcgctgttcgaacccgccctggatggcttacaaaacgccgaacagagag
agcaggacgaaggcagaccagaagaaaaagaagaggatcgcgacgcagggattagcgtggaggttcagattggacgtaaa
ttacgtgaaatgggggatcagtttcagcaagagcatcttcagctgtttactcaaaggggccaaatgggtttgttccagct
catgacgtcgatctacaacttcctttttccccaagagagaccccaaaatgcaagagcccacagatga
>gnl|bcl2dbcds|Q0GKC4_uncBMF-02 Putative Bcl2 modifying factor gene OS=[Eukaryota] Danio rerio (length=681 residues).
atggatgatgaggaggatgaacagcttcctcgctgctgtgaaacgccgctaagaaacaagcgctcagagaagagagacgc
ccacggtggagacgtgggacaaacagctcacagacacgcatccacacagactgctggctctgtcctcaattcagcgagag
acgcagatatggcaccattccagggctcacagagagaagcatcatctctttgcagagttgtgggtgctaggactgcattc
agggctccctgtggaactgggggccttgtgtcacttactatgggccccggagcccggggtgggccaagagcactttttca
tggaaacgctggatttcgtgcacacttccctgcgctgttcgaacccgccctggatggcttacaaaacgccgaacagagag
agcaggacgaaggcagaccagaagaaaaagaagaggatcgcgacgcagggattagcgtggaggttcagattggacgtaaa
ttacgtgaaatgggggatcagtttcagcaagagcatcttcagctggtaagagtcattcacatcagactgattcttttctt
caaggccgctgggtttcagatgtgtgtggtcagaaactggtggtttcagtcacgatgcaaaatgacatcactgtctgcta
tttcagtgttgaatatgcaaattcccaagagggagcgatga
>gnl|bcl2dbcds|A0A3P8ZI98_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Esox lucius (length=480 residues).
cctgactcagcctttatagataaactgtctaaatgtgtacatgtctcctcaacgtccagtctctcagcgctggggcgccc
ccttcagggagatcaagatcccagacacagacgccgcagacaggcaggacaggtccactcagacttccactgggtcttcg
gtaccccggtccgagggacagaacaccgtgggcccaccaggcaccatcaaccacaccgtgcccacattcatgttcctttc
acaggcaacgctggattccgaagtcactttccagctgagtttgagcccatggatgatcgaggagaaggaatggaggagag
acaggaggaggagcaggtagaggatagtgtggaggagaggatcggtcggaagcttcgggagataggcgatcagttccatg
aagaccacgttcaactggtgagggtcaaacaaatgtgcattcagggctggaaccacctgttttctgatattctcttttag
>gnl|bcl2dbcds|A0A452H537_uncHRK-01 Putative Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Gopherus agassizii (length=264 residues).
atgtgcccctgcgcgctgcacggcgggccccccgccgcttgcccctgcagctccgcccggcgcggggcgcgcttctccgg
ggctcagctggtggcggcccgcctgaagctggtcggggatgagctgcaggagcggaccgcgtggcgcagggcgagcagca
ggcgagctgcggccgggagaagcctggccacctacctgtgtctgctgtgcgccgcctcgcaggtggccgcgctggtctgg
ctgatccgcaagaggagctggtag
>gnl|bcl2dbcds|A0A3Q4AXL5_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Mola mola (length=438 residues).
atgccgtataaaaacaaaatagatacaagatctccatgtgactgcttccacgctgtgtttcccccaccgtcctgtgccgc
tggagccccagcgcaaataagccgttccgacaacggtggcgagcggcgctccagcggattcggagaaccggactcgccgt
cctggcgcgggatcattcccgtcgacagtctaggcgtgtttcagacgatatttcacctcccacgaagcctctccatcgga
tatttctccgccgacggtgactcgctgcctacctcgccgctctccccgaggccaccgacggctgacagagcgacacagac
tccgagcctcagcggccaggcgatgcaacacgccctgcagcgcatggccgggctgtgcggcggagaaccggggaccacgg
ggttaatccgacaaatgtgggatatacaaccgatgtag
>gnl|bcl2dbcds|G1PFC4_uncBIK-01 Putative BCL2-interacting killer gene OS=[Eukaryota] Myotis lucifugus (length=240 residues).
atgtctcaagcaggacacctctccaggagcctcatcttgtgcaccttcctgcaggagcacgggctgcaagcggtggagga
tcccggcgtgaccagcctcctccagtactcgcctgagcccctgggccctcgcagagccctccctcacgaggtggccatgc
ggctggccttcattggggacgagttggaagtgagatggacgctgccccgctttgcccacgtgccctggatggccatgtac
>gnl|bcl2dbcds|W5P3K2_uncHRK-01 Putative Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Ovis aries (length=129 residues).
atgtggcggcggcgcgcgcggggcgggggggcgccggcgcccggcgcgctccctacctactggccctggctgtgcgcggc
cgcgcaggtggcggcgctggcggcctggctgctcggcaggcggaacttg
>gnl|bcl2dbcds|A0A3B4DQ45_uncBBC3-01 Putative BCL2 binding component 3 gene OS=[Eukaryota] Pygocentrus nattereri (length=561 residues).
atggctcggccgcagatggacagcagggtggacagtcagagtcccacggcaccgcagagctgcaggatggaggtgctgcg
tcgggacgcctggcccagtggaggcacacattcagcctctcaggcccgccaccggcatcggaccatggccactcagacca
gccctgtactcctgtcccatgcccgcacacaagatgctgcaagcttgcccaacaccaaccagcaagacggcccacttaga
gacaacacaggaaccgaaccggagcggtcctcatctgctgagacacagcagcctctgcatgatctcacagctgaaagcca
cagttcctcagcagactccagccgcagagaatcccctgccgaggaggagcccacgccggaggagcaagccatccatagag
tggccatccagctgaggaccataggggatgacatgaatgcagtttaccttcagagaaggaacgaggctcctcagtggcag
aactggagaggcctgtatcgtggtttggtggccttccttgctgacaccatcagcaccctctaccagcatggagtcagata
a
>gnl|bcl2dbcds|A0A3B4XK57_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Seriola lalandi dorsalis (length=420 residues).
atggatgatgaggaggaggacatgtcacagcccatctcgaacctctggggaacgtcctttagggacgtcaaatacgaaga
ccgagccacaccgattgcagccggacaggcccttactgccgtcaccgctgctcctctcattctttttgtttggtgggttc
ctcattgggaactgtcccccagtaccaaaatgaatatgttaagattctcagagaataggcccgaggagcaggcaggggtg
agcgtcgaggcgcaaattggccgtaaacttcgggagattggagacaagttccaacaggatcatttcatgaggcaccagag
acaaaacctgcctgcctggatgcgccttacgatggccctgtttggctttctgtttccaagacaggctctcgtcccccgcc
tgagaggagagcagagatga
>gnl|bcl2dbcds|A0A3B5B3B7_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Stegastes partitus (length=666 residues).
agtgatgagagtccaggctcacggtgcccgacagagggaagcggagcggatccagaacccgccggtgccgctggagcctc
ggcgcaaaagtcccgttcgaacgaggagcggagcgtcgggcagcgcagctccgccggaggagagccggactcaccgccgt
ggtgcccggccagcctaggcgtgtttcagaccaggtcgatatttcacctccctcgccgctcctccagtggatatttctcc
gccgacggtgccgactcggtgccgagctctccgctcttcctgaagcgactgacggctgacaaagccacgcagactcggag
ccccagcggccaggtgatcgaacacgccatggggcgcatggctgacgaggcgcacgaggcagtaggacgagcgctccgac
gaattggagatgactacgataggattctcatggtacgggtaagagacggccagtgtttgtgtgtctgtgtgtcggaggag
ggatgtgggcatcgacagcaaccgccagcagatacgttcgtacagatgttgaccaaagtcctgaaaactgcagtagagca
gctgttttgtcaaatcctgctttattttatctttttttttattatggtgggttatcttagctcatccaatgtgaagcccc
acgtggaaacaggcggcgtgaaatga
© 1998-2019