Dataset for CDS Unclassified of organism all

[Download (right click)]

7 sequence(s)

>gnl|bcl2dbcds|B6IM60_uncEGL1-01 Putative Egg-laying defective 1 gene OS=[Eukaryota] Caenorhabditis briggsae (length=405 residues).
atggattctcgcttccaattctcttcttcatcatcatgtttcaatcgtcccacaaaactgtccaaaaacgtcaaatttga
gttttcgagtcaggaaatcgcattggatcgtttcaacaccacccgaatggaacctttcttctccattggccacactattg
gaaagcaacttagtaaattatgcgacgactttgacaaggagatgatggcgcatgctcacaaaacgtcgatcgttgcaact
gtgaaatcgctatggaacgtcatgttcaccaacttctctccccaagaagctttttgttttgacgtaaaaaacaagaacag
ccgcactcgtcgccattgctccgttattgccaagcgttgccgagttctcttctccaaagttttcaatttcatcatcaagt
gttaa
>gnl|bcl2dbcds|Q9TY06_uncEGL1-01 Putative Egg-laying defective 1 gene OS=[Eukaryota] Caenorhabditis elegans (length=297 residues).
atgatgtcgtacaagcgtgatggatatttttcaattgtgtcaagctgcctaattttttgtctacactttctcccgctgtt
gtctattaggaccaaattaagctccctgtttatcacttctctcgcaaataatgcttgcaactcaaacaccgttgaatata
atattggcagaaaactgacagttatgtgcgacgagtttgactctgaactgatgtcctacaaagaagaaaaatcatttgtg
aaatttctaggctcaggattcaagacgtatgccagcattgttcgtcgtgttttttaa
>gnl|bcl2dbcds|A0A2R8RYV1_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Danio rerio (length=681 residues).
atggatgatgaggaggatgaacagcttcctcgctgctgtgaaacgccgctaagaaacaagcgctccgagaagagagacgc
ccacggtggagacgtgggacaaacagctcacagacacgcatccacacagactgctggctctgtcctcaattcagcgagag
acgcagatatggcaccattccagggctcacagagagaagcatcatctctttgcagagttgtgggtgctaggactgcattc
agggctccctgtggaactgggggccttgtgtcacttactatgggccccggagcccggggtgggccaagagcactttttca
tggaaacgctggatttcgtgcacacttccctgcgctgttcgaacccgccctggatggcttacaaaacgccgaacagagag
agcaggacgaaggcagaccagaagaaaaagaagaggatcgcgacgcagggattagcgtggaggtccagattggacgtaaa
ttacgtgaaatgggggatcagtttcagcaagagcatcttcagctggtaagagtcattcacatcagactgattcttttctt
caaggccgctgggtttcagatgtgtgtggtcagaaactggtggtttcagtcacgatgcaaaatgacatcactgtctgcta
tttcagtgctgaatatgcaaattcccaagagggagcaatga
>gnl|bcl2dbcds|Q0GKC4_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Danio rerio (length=627 residues).
atggatgatgaggaggatgaacagcttcctcgctgctgtgaaacgccgctaagaaacaagcgctcagagaagagagacgc
ccacggtggagacgtgggacaaacagctcacagacacgcatccacacagactgctggctctgtcctcaattcagcgagag
acgcagatatggcaccattccagggctcacagagagaagcatcatctctttgcagagttgtgggtgctaggactgcattc
agggctccctgtggaactgggggccttgtgtcacttactatgggccccggagcccggggtgggccaagagcactttttca
tggaaacgctggatttcgtgcacacttccctgcgctgttcgaacccgccctggatggcttacaaaacgccgaacagagag
agcaggacgaaggcagaccagaagaaaaagaagaggatcgcgacgcagggattagcgtggaggttcagattggacgtaaa
ttacgtgaaatgggggatcagtttcagcaagagcatcttcagctgtttactcaaaggggccaaatgggtttgttccagct
catgacgtcgatctacaacttcctttttccccaagagagaccccaaaatgcaagagcccacagatga
>gnl|bcl2dbcds|Q0GKC4_uncBMF-02 Putative Bcl2 modifying factor gene OS=[Eukaryota] Danio rerio (length=681 residues).
atggatgatgaggaggatgaacagcttcctcgctgctgtgaaacgccgctaagaaacaagcgctcagagaagagagacgc
ccacggtggagacgtgggacaaacagctcacagacacgcatccacacagactgctggctctgtcctcaattcagcgagag
acgcagatatggcaccattccagggctcacagagagaagcatcatctctttgcagagttgtgggtgctaggactgcattc
agggctccctgtggaactgggggccttgtgtcacttactatgggccccggagcccggggtgggccaagagcactttttca
tggaaacgctggatttcgtgcacacttccctgcgctgttcgaacccgccctggatggcttacaaaacgccgaacagagag
agcaggacgaaggcagaccagaagaaaaagaagaggatcgcgacgcagggattagcgtggaggttcagattggacgtaaa
ttacgtgaaatgggggatcagtttcagcaagagcatcttcagctggtaagagtcattcacatcagactgattcttttctt
caaggccgctgggtttcagatgtgtgtggtcagaaactggtggtttcagtcacgatgcaaaatgacatcactgtctgcta
tttcagtgttgaatatgcaaattcccaagagggagcgatga
>gnl|bcl2dbcds|G1PFC4_uncBIK-01 Putative BCL2-interacting killer gene OS=[Eukaryota] Myotis lucifugus (length=240 residues).
atgtctcaagcaggacacctctccaggagcctcatcttgtgcaccttcctgcaggagcacgggctgcaagcggtggagga
tcccggcgtgaccagcctcctccagtactcgcctgagcccctgggccctcgcagagccctccctcacgaggtggccatgc
ggctggccttcattggggacgagttggaagtgagatggacgctgccccgctttgcccacgtgccctggatggccatgtac
>gnl|bcl2dbcds|W5P3K2_uncHRK-01 Putative Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Ovis aries (length=129 residues).
atgtggcggcggcgcgcgcggggcgggggggcgccggcgcccggcgcgctccctacctactggccctggctgtgcgcggc
cgcgcaggtggcggcgctggcggcctggctgctcggcaggcggaacttg
© 1998-2019